ID: 1096067217

View in Genome Browser
Species Human (GRCh38)
Location 12:48750545-48750567
Sequence TGACCTTATGGACCACCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096067207_1096067217 26 Left 1096067207 12:48750496-48750518 CCTGCTACTGCTGAGGTTGCTTG No data
Right 1096067217 12:48750545-48750567 TGACCTTATGGACCACCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096067217 Original CRISPR TGACCTTATGGACCACCATG GGG Intergenic
No off target data available for this crispr