ID: 1096067833

View in Genome Browser
Species Human (GRCh38)
Location 12:48755201-48755223
Sequence GAGACTATGAAGGACATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096067833_1096067839 21 Left 1096067833 12:48755201-48755223 CCCTACATGTCCTTCATAGTCTC No data
Right 1096067839 12:48755245-48755267 TTATGGCAACCCCCAATTTGTGG No data
1096067833_1096067836 -7 Left 1096067833 12:48755201-48755223 CCCTACATGTCCTTCATAGTCTC No data
Right 1096067836 12:48755217-48755239 TAGTCTCTTCAAAGCATTAAAGG No data
1096067833_1096067837 -4 Left 1096067833 12:48755201-48755223 CCCTACATGTCCTTCATAGTCTC No data
Right 1096067837 12:48755220-48755242 TCTCTTCAAAGCATTAAAGGTGG No data
1096067833_1096067838 4 Left 1096067833 12:48755201-48755223 CCCTACATGTCCTTCATAGTCTC No data
Right 1096067838 12:48755228-48755250 AAGCATTAAAGGTGGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096067833 Original CRISPR GAGACTATGAAGGACATGTA GGG (reversed) Intergenic
No off target data available for this crispr