ID: 1096067838

View in Genome Browser
Species Human (GRCh38)
Location 12:48755228-48755250
Sequence AAGCATTAAAGGTGGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096067834_1096067838 3 Left 1096067834 12:48755202-48755224 CCTACATGTCCTTCATAGTCTCT No data
Right 1096067838 12:48755228-48755250 AAGCATTAAAGGTGGTTTTATGG No data
1096067832_1096067838 26 Left 1096067832 12:48755179-48755201 CCACTCAAGTACTTTTATATGAC No data
Right 1096067838 12:48755228-48755250 AAGCATTAAAGGTGGTTTTATGG No data
1096067835_1096067838 -6 Left 1096067835 12:48755211-48755233 CCTTCATAGTCTCTTCAAAGCAT No data
Right 1096067838 12:48755228-48755250 AAGCATTAAAGGTGGTTTTATGG No data
1096067833_1096067838 4 Left 1096067833 12:48755201-48755223 CCCTACATGTCCTTCATAGTCTC No data
Right 1096067838 12:48755228-48755250 AAGCATTAAAGGTGGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096067838 Original CRISPR AAGCATTAAAGGTGGTTTTA TGG Intergenic
No off target data available for this crispr