ID: 1096067839

View in Genome Browser
Species Human (GRCh38)
Location 12:48755245-48755267
Sequence TTATGGCAACCCCCAATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096067835_1096067839 11 Left 1096067835 12:48755211-48755233 CCTTCATAGTCTCTTCAAAGCAT No data
Right 1096067839 12:48755245-48755267 TTATGGCAACCCCCAATTTGTGG No data
1096067833_1096067839 21 Left 1096067833 12:48755201-48755223 CCCTACATGTCCTTCATAGTCTC No data
Right 1096067839 12:48755245-48755267 TTATGGCAACCCCCAATTTGTGG No data
1096067834_1096067839 20 Left 1096067834 12:48755202-48755224 CCTACATGTCCTTCATAGTCTCT No data
Right 1096067839 12:48755245-48755267 TTATGGCAACCCCCAATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096067839 Original CRISPR TTATGGCAACCCCCAATTTG TGG Intergenic
No off target data available for this crispr