ID: 1096072594

View in Genome Browser
Species Human (GRCh38)
Location 12:48783475-48783497
Sequence GGTATTAATACCACTCCTAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096072594 Original CRISPR GGTATTAATACCACTCCTAC TGG (reversed) Exonic
901706143 1:11074715-11074737 GGTATTAATATCACTGTTACTGG - Intronic
905929279 1:41775779-41775801 GGTATCAAAACCACTCCTTCTGG - Intronic
907754068 1:57292856-57292878 GGTATAAATACCACGCACACTGG + Intronic
910244119 1:85120586-85120608 GATATTAATAACTCTCTTACAGG + Intronic
917074377 1:171188714-171188736 TGTATTTACACAACTCCTACTGG + Intronic
1068265414 10:54642127-54642149 GGCATTAATCCCACTCATAAGGG - Intronic
1071279828 10:84090838-84090860 GGTACTAATCCCACTCATAAGGG + Intergenic
1073262787 10:102203200-102203222 GGTAATGAAACCACTCCTAGAGG - Intergenic
1078227586 11:9406426-9406448 TTTATTAATATCACTCCTAAAGG - Intronic
1080340375 11:31256397-31256419 GGGATTTATACTACTCCTTCAGG + Intronic
1087693722 11:101351826-101351848 GTTTTTAATACCACACCTCCAGG + Intergenic
1096072594 12:48783475-48783497 GGTATTAATACCACTCCTACTGG - Exonic
1097440471 12:59601884-59601906 TGTCTTAATACCACTCCTTTGGG + Intronic
1098416973 12:70244519-70244541 GGTAGTAATACCGTACCTACAGG - Intronic
1099573389 12:84354091-84354113 GGGCTGAAGACCACTCCTACAGG + Intergenic
1105064461 12:133184542-133184564 GGTATTAATCCCATTCCTGAAGG + Intronic
1105429393 13:20323726-20323748 GGAATAAATGCCACTCCTAGTGG + Intergenic
1126171091 15:45695921-45695943 GGTATTATTACCCATCCTACAGG - Intergenic
1135873029 16:26169792-26169814 GGGAATAATACCACTGCTGCTGG + Intergenic
1135931796 16:26744334-26744356 TTTATTAATATCACTGCTACTGG + Intergenic
1149926873 17:60710168-60710190 GGTATAAATTCAACTTCTACTGG - Intronic
1157414136 18:47488215-47488237 GGGATTTATAGCCCTCCTACAGG + Intergenic
1157747739 18:50151169-50151191 GTTTTTAATCCCACTCCCACAGG + Intronic
1158263153 18:55631864-55631886 GGTATTAATTCCAATTCTGCAGG + Intronic
1158788219 18:60741061-60741083 GGTGTTAATCCCACTCCTGAGGG + Intergenic
1159757200 18:72380249-72380271 GGTATAAAGACCACTGCAACAGG - Intergenic
1164564159 19:29314258-29314280 GGTATTATTCCCACTTCCACTGG + Intergenic
929165850 2:38880650-38880672 GGTATTCATACCACTCCTAATGG + Exonic
932867912 2:75365702-75365724 GGAGTTGATACCACTCCTACTGG - Intergenic
933869732 2:86554040-86554062 GGCATTAATTCCATTCCTAAGGG - Intronic
943874998 2:193055529-193055551 TTTATTAAAACAACTCCTACAGG - Intergenic
947040104 2:225908671-225908693 GATATTATTACCACTCTTAAGGG - Intergenic
947382549 2:229559272-229559294 GGTATTAAAACCACTGGGACAGG + Intronic
1171145207 20:22775268-22775290 GGCATTGATACCTCTCCCACAGG + Intergenic
1174208161 20:48856318-48856340 TCCATTAATAACACTCCTACTGG - Intergenic
1182634680 22:31716070-31716092 GGTTTTAATACCTCACTTACAGG + Exonic
951202281 3:19889033-19889055 GGTTTTCATAACACTCCTATGGG + Intronic
954896993 3:53984073-53984095 GCTATTATTGCCACTCCTGCGGG + Intergenic
960874863 3:122286218-122286240 AGTATTAATACCACTGCTGGAGG - Exonic
968435560 4:586403-586425 GCTATTAATACAGCTACTACAGG + Intergenic
969398391 4:6938017-6938039 GGTCTTCATTCCACTCCTCCCGG + Intronic
970995841 4:22266961-22266983 GGGATTAATACCACTGTTATGGG + Intergenic
972797540 4:42436935-42436957 TTTATTAATACCTTTCCTACAGG + Intronic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
978298061 4:107232338-107232360 TGTATTAATTACATTCCTACTGG - Intronic
979473672 4:121129803-121129825 GGTATTTATACCTCTCCTGCTGG + Intergenic
1001677251 5:173528813-173528835 GGTACTAATACCATTCCTAAGGG - Intergenic
1013835470 6:114330043-114330065 GACATTTATACCACTCCCACCGG - Intronic
1020452898 7:8340088-8340110 GGTCCTACTACCACTTCTACTGG + Intergenic
1027987855 7:85317727-85317749 GGCAATAATCCCACTCCTAAGGG + Intergenic
1032644494 7:133807379-133807401 ATTATTAATACAGCTCCTACTGG + Intronic
1033364176 7:140658895-140658917 GGTTTTAATTCTACTACTACTGG - Intronic
1034916955 7:155048009-155048031 GGCATTAATCCCATTCCTATGGG - Intergenic
1036538513 8:9677447-9677469 GGTTTTATTACCACTCTTATTGG + Intronic
1039124352 8:34184446-34184468 GATATTAATACCAGTCTCACAGG - Intergenic
1040565393 8:48562193-48562215 GATATTAATATAACTACTACTGG + Intergenic
1040970987 8:53137574-53137596 GTTAGGAATACCACTGCTACAGG - Intergenic
1042419601 8:68570123-68570145 AGTATCAAAACCATTCCTACAGG + Intronic
1043336008 8:79177947-79177969 GGTAATAAGAACACTACTACAGG - Intergenic
1044954858 8:97469545-97469567 GTTATTACTAACACTCCTTCTGG + Intergenic
1046592311 8:116221144-116221166 GGTACTAATCCCACTCATAAGGG - Intergenic
1048476713 8:134749494-134749516 GGCATTAATACCACTCTTGAGGG + Intergenic
1060813465 9:126622934-126622956 GGTAGTAATTCCAATCTTACAGG + Intronic
1062236309 9:135510165-135510187 GATATTAATATAACTCCTCCTGG - Intergenic
1198912549 X:141630581-141630603 GGTATAAATTCCACTTCTTCAGG + Intronic