ID: 1096073759

View in Genome Browser
Species Human (GRCh38)
Location 12:48789476-48789498
Sequence GACCCTCGGTGGGCGGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 6, 3: 21, 4: 295}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096073759_1096073774 5 Left 1096073759 12:48789476-48789498 CCCCGCCCCGCCCACCGAGGGTC 0: 1
1: 0
2: 6
3: 21
4: 295
Right 1096073774 12:48789504-48789526 CCTTCCTGTCAGGGTCCCAGGGG 0: 1
1: 0
2: 2
3: 30
4: 275
1096073759_1096073772 4 Left 1096073759 12:48789476-48789498 CCCCGCCCCGCCCACCGAGGGTC 0: 1
1: 0
2: 6
3: 21
4: 295
Right 1096073772 12:48789503-48789525 TCCTTCCTGTCAGGGTCCCAGGG 0: 1
1: 0
2: 1
3: 15
4: 239
1096073759_1096073777 10 Left 1096073759 12:48789476-48789498 CCCCGCCCCGCCCACCGAGGGTC 0: 1
1: 0
2: 6
3: 21
4: 295
Right 1096073777 12:48789509-48789531 CTGTCAGGGTCCCAGGGGTTGGG 0: 1
1: 0
2: 3
3: 35
4: 361
1096073759_1096073771 3 Left 1096073759 12:48789476-48789498 CCCCGCCCCGCCCACCGAGGGTC 0: 1
1: 0
2: 6
3: 21
4: 295
Right 1096073771 12:48789502-48789524 TTCCTTCCTGTCAGGGTCCCAGG 0: 1
1: 1
2: 4
3: 25
4: 271
1096073759_1096073769 -4 Left 1096073759 12:48789476-48789498 CCCCGCCCCGCCCACCGAGGGTC 0: 1
1: 0
2: 6
3: 21
4: 295
Right 1096073769 12:48789495-48789517 GGTCGCCTTCCTTCCTGTCAGGG 0: 1
1: 0
2: 0
3: 8
4: 126
1096073759_1096073776 9 Left 1096073759 12:48789476-48789498 CCCCGCCCCGCCCACCGAGGGTC 0: 1
1: 0
2: 6
3: 21
4: 295
Right 1096073776 12:48789508-48789530 CCTGTCAGGGTCCCAGGGGTTGG 0: 1
1: 0
2: 3
3: 43
4: 459
1096073759_1096073778 14 Left 1096073759 12:48789476-48789498 CCCCGCCCCGCCCACCGAGGGTC 0: 1
1: 0
2: 6
3: 21
4: 295
Right 1096073778 12:48789513-48789535 CAGGGTCCCAGGGGTTGGGCCGG 0: 1
1: 0
2: 4
3: 65
4: 533
1096073759_1096073768 -5 Left 1096073759 12:48789476-48789498 CCCCGCCCCGCCCACCGAGGGTC 0: 1
1: 0
2: 6
3: 21
4: 295
Right 1096073768 12:48789494-48789516 GGGTCGCCTTCCTTCCTGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096073759 Original CRISPR GACCCTCGGTGGGCGGGGCG GGG (reversed) Intergenic
900124874 1:1064835-1064857 TGCCCTCGGTGGGAGGGGTGTGG + Intergenic
900344593 1:2204953-2204975 GGCGCCCGGGGGGCGGGGCGGGG - Intronic
901103529 1:6737642-6737664 GACACCAGGTGGGCGGGGAGGGG + Intergenic
901104083 1:6741804-6741826 GACCCTTTGTGGACCGGGCGAGG + Intergenic
902275587 1:15337166-15337188 GACCCTGGATGGGCTGGGCTGGG + Intronic
905044517 1:34985308-34985330 AACCCACGGTGGGGGGAGCGCGG - Exonic
905107901 1:35574868-35574890 GACCCTGGGTGGCAGGGGCTTGG + Intronic
905505561 1:38476526-38476548 GCTCCTGGGTGGGGGGGGCGCGG - Intergenic
906168975 1:43707784-43707806 GTCCCGGGCTGGGCGGGGCGCGG + Intronic
906520916 1:46466512-46466534 GGCCCGAGGAGGGCGGGGCGGGG - Intergenic
906650325 1:47508282-47508304 GGGCCGCGGGGGGCGGGGCGCGG + Intergenic
907105522 1:51878928-51878950 AACCCAAAGTGGGCGGGGCGAGG + Intronic
907304630 1:53506850-53506872 GACCCTGGGCAGGCGGGGTGGGG - Intronic
911902718 1:103525661-103525683 GACCGTCACAGGGCGGGGCGGGG - Intergenic
913047947 1:115089537-115089559 GGCCTCCGGGGGGCGGGGCGGGG + Intergenic
913581599 1:120232751-120232773 GACCTTCGTTGGGATGGGCGAGG + Intergenic
913626578 1:120665637-120665659 GACCTTCGTTGGGATGGGCGAGG - Intergenic
914563531 1:148844198-148844220 GACCTTCGTTGGGATGGGCGAGG + Intronic
914609296 1:149286027-149286049 GACCTTCGTTGGGATGGGCGAGG - Intergenic
915130243 1:153690649-153690671 GACCCTCTGTGGGCCGGGCGTGG + Intronic
915495423 1:156279225-156279247 GTCCCCTGGTGGGCGGGGGGTGG - Intronic
916782982 1:168056333-168056355 GGGCCTCGGCGGGCAGGGCGCGG + Intronic
917964538 1:180170016-180170038 GGCCCTCTGTGGGCAGGGCGAGG + Intronic
919767028 1:201134127-201134149 GAACCTTTGTGGGCTGGGCGCGG - Intergenic
920095028 1:203481013-203481035 GACCTGTGCTGGGCGGGGCGGGG - Intronic
920491023 1:206415486-206415508 GCCCCTCGGTGGGAGGAGGGGGG - Intronic
1063520265 10:6734804-6734826 GACCCTCTGGGGGTGGGGCAAGG + Intergenic
1064185901 10:13161637-13161659 GACCCTCGGGCGGCGGGGCCGGG + Intronic
1065046580 10:21751871-21751893 GACCCTCTGTGGGCGGGGGGGGG + Intergenic
1065177761 10:23095654-23095676 GCGCCTCGGCGGGCGGTGCGGGG + Exonic
1070162314 10:73873934-73873956 CACCCGCGGGGGGCGGGGCCGGG + Intronic
1070865219 10:79704508-79704530 GCCCCTGGGTGGGCGAGGCTGGG + Intronic
1070879010 10:79842639-79842661 GCCCCTGGGTGGGCGAGGCTGGG + Intronic
1071086806 10:81875160-81875182 GCCTCTCGGGGGGAGGGGCGTGG + Intergenic
1071314555 10:84381635-84381657 CATCCACGGTGGGCCGGGCGCGG + Intronic
1071632117 10:87226729-87226751 GCCCCTGGGTGGGCGAGGCTGGG + Intronic
1071645570 10:87358948-87358970 GCCCCTGGGTGGGCGAGGCTGGG + Intronic
1072503408 10:96041702-96041724 GACCATGGGTGGGCTGGGTGTGG - Intergenic
1074377156 10:112950150-112950172 CAGCCGGGGTGGGCGGGGCGGGG - Intergenic
1075040535 10:119104060-119104082 GCCCTACGGCGGGCGGGGCGGGG + Intergenic
1076793387 10:132787849-132787871 GACCCTGGGCGGGCCGGGAGGGG + Intergenic
1076877228 10:133221863-133221885 AACCCTAGGTGGGCAGGGCTGGG + Intronic
1076877250 10:133221947-133221969 AACCCTAGGTGGGCCGGGCTGGG + Intronic
1076877261 10:133221989-133222011 AACCCTAGGTGGGCCGGGCGCGG + Intronic
1077017290 11:402839-402861 GTCCCGGGGTGAGCGGGGCGGGG - Intronic
1077495788 11:2885958-2885980 CACCCACCGGGGGCGGGGCGGGG + Intergenic
1078057561 11:8019719-8019741 GGCCCCTGGCGGGCGGGGCGAGG + Intronic
1078137370 11:8662409-8662431 GTCCCTCGGTGGGCAGGCCTTGG - Intronic
1079235841 11:18689582-18689604 GAGCCTATGTGGGCCGGGCGTGG + Intergenic
1079803116 11:24896227-24896249 GCCCCTCTGTGGGCTGGCCGAGG + Intronic
1079999310 11:27329435-27329457 GTACCTCGGTGGGCGGGTGGGGG - Intergenic
1080569763 11:33545184-33545206 GACTGTCAGTGGGCGTGGCGTGG - Exonic
1081046459 11:38279022-38279044 GACCCTCTCTGGGCTGGCCGAGG - Intergenic
1081672409 11:44949633-44949655 GCGCCCCGCTGGGCGGGGCGGGG - Intronic
1082002377 11:47400270-47400292 GGCCCTAGGGGGGCGGGGCCGGG - Intergenic
1083278038 11:61608669-61608691 GAGCCTCGGTGGGCCAGGTGGGG - Intergenic
1083687342 11:64384518-64384540 GACCGAAGGTGGGCGGGGCGCGG + Intergenic
1083766682 11:64844745-64844767 GTCCGTCGGGGGGCGGGGCGCGG - Intergenic
1084175711 11:67421212-67421234 GGCTCCAGGTGGGCGGGGCGCGG + Exonic
1084503959 11:69553704-69553726 GACCCTGGGAGGGCAGGGCCTGG - Intergenic
1088172804 11:107017738-107017760 CGCCCTCGGTGAGCGGGGGGCGG - Exonic
1088844018 11:113649735-113649757 GACCCTCTCTGGGCTGGCCGAGG - Intergenic
1091219297 11:133920709-133920731 GCCCCTCGGTGGGCAGGGGCGGG + Exonic
1091491955 12:940306-940328 TACCCTCTGTTGGCCGGGCGCGG + Intronic
1091610644 12:2004613-2004635 GATCCTCAGTGGGCGGGGCGCGG - Intronic
1092169291 12:6363375-6363397 GCCCATGGGTGGGCGGGGCCAGG + Intronic
1096073759 12:48789476-48789498 GACCCTCGGTGGGCGGGGCGGGG - Intergenic
1096495436 12:52037120-52037142 CTCCCCCGGCGGGCGGGGCGGGG - Intronic
1096967843 12:55642815-55642837 GACACACGGTGTGGGGGGCGGGG + Intergenic
1096983180 12:55740582-55740604 GACACTAGGTAGGCCGGGCGCGG - Intergenic
1097246899 12:57611824-57611846 GAATCACGGGGGGCGGGGCGGGG - Intronic
1098482497 12:70982029-70982051 CACCCTGGGTGGGCATGGCGGGG + Intergenic
1099489459 12:83270345-83270367 GATTCTCTGTGGGCTGGGCGTGG - Intergenic
1102962012 12:117099197-117099219 TACCCGCGGGGGGCGGCGCGGGG - Intronic
1103775604 12:123364615-123364637 CACCCTCGGGGGGCCGTGCGGGG - Intronic
1103925817 12:124422927-124422949 GACCCTGTGTGGGCTGGGTGAGG - Intronic
1103954644 12:124569214-124569236 GACCCTTGGTGGGGGAGGTGGGG - Intergenic
1105045915 12:133003000-133003022 GACCCTAGGTGGGTGGGACCTGG + Intronic
1107513862 13:41110139-41110161 TAGCCTGGGTGGGCCGGGCGCGG + Intergenic
1107935674 13:45343248-45343270 GACCCCATCTGGGCGGGGCGGGG - Intergenic
1110573000 13:77026744-77026766 GACCGTCTGTGGGCGGGCCGGGG - Intronic
1113739639 13:112702407-112702429 AACACGCGGGGGGCGGGGCGGGG - Intronic
1119734572 14:76973778-76973800 GAGGCTGGGGGGGCGGGGCGGGG - Intergenic
1119887379 14:78154224-78154246 GACCCTCCATTGGCGGGGTGGGG - Intergenic
1120044718 14:79793139-79793161 GACCCACAGTCGGCCGGGCGCGG + Intronic
1120953365 14:90061736-90061758 GACGGTCGCGGGGCGGGGCGGGG - Intergenic
1122126522 14:99581460-99581482 GACCATGGGTGGGGGGAGCGAGG - Intronic
1122208292 14:100159336-100159358 GACCCTCGGGGAGCCGGCCGGGG + Intronic
1122370958 14:101228712-101228734 GACCGTCGGTGGGTGAGGCCTGG - Intergenic
1122662662 14:103308413-103308435 GACCTTCTTTGGGCTGGGCGTGG + Intergenic
1122690238 14:103528813-103528835 AACCCGCGGCCGGCGGGGCGGGG + Intergenic
1123004388 14:105314450-105314472 GGCTCCCGGGGGGCGGGGCGGGG + Exonic
1124953145 15:34341963-34341985 GACCCTCAGAGGACAGGGCGCGG + Exonic
1125522918 15:40358179-40358201 GCCGGTCGCTGGGCGGGGCGAGG - Intergenic
1125602965 15:40925639-40925661 GCCCCTCGAGGGGAGGGGCGAGG + Intergenic
1126042155 15:44601870-44601892 GAGGCTGGGTGGGCTGGGCGCGG - Intronic
1126143109 15:45453748-45453770 AACCTTCAGTGGGCCGGGCGTGG - Intergenic
1126276976 15:46895057-46895079 GACTCTCAGTGCGGGGGGCGGGG + Intergenic
1129444814 15:75609477-75609499 GACCCACTTTGGGCCGGGCGCGG - Intronic
1131144290 15:90001563-90001585 GGCCCTCGGCGGGCCGGGCCGGG - Exonic
1132560018 16:589369-589391 AACCCTCGGAGGGAGCGGCGGGG - Exonic
1132580103 16:680744-680766 GACCCTCGGTGGGGCCGGCCGGG - Intronic
1132683479 16:1153083-1153105 GAGCGGCGGGGGGCGGGGCGGGG - Intergenic
1132697976 16:1210351-1210373 GAACCTGGGTGGGCGGGGGCGGG - Exonic
1133069374 16:3235532-3235554 GGCGCTGGGTGGGCGGGGGGTGG - Intronic
1133231945 16:4371079-4371101 CACCGTCGGTGGGTGGGGCCTGG - Intronic
1135115384 16:19718850-19718872 GAAGCTCTGTGGGCGGGGCCTGG - Intronic
1135206904 16:20492160-20492182 GGCCCTCGGTGGGGTGGGCGGGG - Intergenic
1135211981 16:20531472-20531494 GGCCCTCGGTGGGGTGGGCGGGG + Intergenic
1135321865 16:21502541-21502563 GACCTGCGGTGGGGGGGGGGGGG + Intergenic
1136460636 16:30407974-30407996 GGGCCACGGTGGGCGGGGGGGGG + Intronic
1139013073 16:62657107-62657129 GACACACTGTGGGCTGGGCGTGG - Intergenic
1139466916 16:67159166-67159188 GACTCCTGGTGGGTGGGGCGCGG - Intronic
1140481674 16:75265748-75265770 GGCCCGCAGCGGGCGGGGCGAGG + Intronic
1141086024 16:81096189-81096211 GGGCCTCGGCGGGCAGGGCGCGG + Exonic
1141751544 16:85961721-85961743 GAAGCTCGGGGGGCGGGGGGCGG - Intergenic
1142338631 16:89506844-89506866 GACACCAGGTGGGCCGGGCGCGG - Intronic
1142419972 16:89964103-89964125 GACCATGGGTGGGCGGTGGGAGG + Intronic
1142812600 17:2402135-2402157 GACCGGCGGTGGGCGGGGCGCGG + Intergenic
1143584568 17:7844773-7844795 GACCCTAGGTGGGAGCCGCGGGG + Intronic
1143780618 17:9226941-9226963 GGGCCTCGGGGGGCGGGGCTGGG - Intronic
1145234995 17:21202076-21202098 GGCCCTGGGTGTGCGGGGAGGGG + Intronic
1147375950 17:40022600-40022622 GACCCTGGGTGGCCGGAGCAGGG + Intronic
1147935194 17:44006958-44006980 GCCCCCCGGTGGGCGGGGCCAGG + Intronic
1149557590 17:57585109-57585131 GACCCTAAGAGGGCTGGGCGTGG - Intronic
1149671001 17:58410014-58410036 GACTCTCGGTTGGTGGGGGGCGG - Intronic
1151297060 17:73193356-73193378 GGCCCGCGGTGGCCGGGGCGCGG - Exonic
1151660674 17:75516509-75516531 CTCCGGCGGTGGGCGGGGCGTGG + Exonic
1151818127 17:76481564-76481586 GAGCAGCGGTGGGCGGTGCGGGG + Intronic
1151849877 17:76684036-76684058 CACCCTGGGTGGGTGGGGGGCGG - Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152650712 17:81491363-81491385 GACCCTCCCTTGGTGGGGCGTGG - Intergenic
1152782091 17:82231133-82231155 GTCCCGCGGCTGGCGGGGCGGGG + Intronic
1153805301 18:8705288-8705310 GGCCGGCGGTGGGCGGGGAGCGG + Intergenic
1154066355 18:11110701-11110723 GACCCGGGGCGGGCGGGCCGGGG - Intronic
1154266665 18:12884367-12884389 GGCGCTCGGGGGGCGGGGCTCGG + Intronic
1155954199 18:31943263-31943285 GAAGCTCCCTGGGCGGGGCGGGG + Intronic
1156474638 18:37397862-37397884 GACCCTGGGTGGAGTGGGCGGGG + Intronic
1158579740 18:58671349-58671371 GGGCCTCGAGGGGCGGGGCGGGG - Intergenic
1159369993 18:67516946-67516968 GGCCGGCGGCGGGCGGGGCGGGG + Exonic
1160565269 18:79783118-79783140 TGCCCTCTGTGGGCGGCGCGTGG + Intergenic
1160603808 18:80034177-80034199 GGCGGTAGGTGGGCGGGGCGAGG - Intergenic
1160657940 19:282866-282888 TCCCTTCTGTGGGCGGGGCGGGG - Intronic
1160863848 19:1248847-1248869 GTGCCCCGGGGGGCGGGGCGGGG - Intronic
1160879040 19:1311236-1311258 GACCCCTGGTGGGGGGGGGGGGG - Intergenic
1160879599 19:1313405-1313427 CCCCCTCGGTGCCCGGGGCGGGG - Intergenic
1161072920 19:2271256-2271278 GCCCCTGCCTGGGCGGGGCGGGG + Intronic
1161108529 19:2456105-2456127 GCCCCGTGGTGGGCGGGGCCTGG + Intronic
1161108605 19:2456357-2456379 ACCCCGCGGTGGGCGGGGCCTGG + Intronic
1161150055 19:2702742-2702764 GACACTCGGGGGGCGGGCCCTGG + Intergenic
1161397561 19:4052584-4052606 CAGCCTCGGTGGGCGTGGCTGGG + Intronic
1161982511 19:7637314-7637336 GACCCTCGAGGGGGCGGGCGGGG + Intronic
1162145613 19:8610939-8610961 GAACCGCGGGGGGCGGGGAGGGG + Intergenic
1162741361 19:12775562-12775584 GCGCCTAGGGGGGCGGGGCGGGG - Intronic
1163255528 19:16153666-16153688 GAAGCTCGGTGGGCGTGGCCTGG + Intronic
1163651725 19:18521781-18521803 GTCCCTGGGCCGGCGGGGCGCGG - Intronic
1163666820 19:18607238-18607260 ACCGCTCGGTGGGGGGGGCGGGG - Intronic
1163672460 19:18636973-18636995 GAGACGCGGGGGGCGGGGCGGGG - Exonic
1165324195 19:35104661-35104683 CACCCTCTGTGGCCTGGGCGGGG + Intergenic
1165751684 19:38264357-38264379 GAACCTGGCGGGGCGGGGCGGGG - Intronic
1166084677 19:40467060-40467082 GGGCCTCGGGCGGCGGGGCGCGG + Intronic
1166139526 19:40798833-40798855 GCCCCGCGCTGGGCGGGGGGCGG + Intronic
1166894518 19:46015497-46015519 GAGCCTAAGGGGGCGGGGCGGGG + Intronic
1167255465 19:48425217-48425239 GACTCTCAGTGGGCGGGCGGGGG + Intronic
1167386331 19:49166223-49166245 GGGCCTCTGTGGGCGGGGCCCGG + Intronic
1167427393 19:49436498-49436520 GGAGCTCGGTGAGCGGGGCGGGG + Intronic
1167507384 19:49878035-49878057 CACCCTCAGGGGGCGGGGCCGGG - Intronic
1168290293 19:55354230-55354252 GAGCCTGGAGGGGCGGGGCGAGG - Exonic
1168353031 19:55687328-55687350 GACCCTCAGTGGGCAGGGAAGGG + Intronic
925532924 2:4884166-4884188 GACCCTCTCTGGGCTGGCCGAGG + Intergenic
926155005 2:10448618-10448640 GACCGCCGCAGGGCGGGGCGGGG - Intergenic
926268196 2:11344724-11344746 GAAGCGCGGTGCGCGGGGCGGGG - Intronic
927751461 2:25673724-25673746 GGCGACCGGTGGGCGGGGCGCGG - Intergenic
927970984 2:27306375-27306397 GACCCTCTGTGTGGGGGGTGCGG + Intronic
928093689 2:28391756-28391778 CTCCCTCGCTGGGCGGGGCTGGG - Intergenic
928599241 2:32886988-32887010 GACCCTCTCTGGGCTGGCCGAGG - Intergenic
928938956 2:36708111-36708133 GGCACTAGGTGGGCGGGGGGGGG - Intronic
929099389 2:38294989-38295011 TTCCCTTGGTGGGCGGGGGGGGG + Exonic
930124344 2:47783885-47783907 CCCACTTGGTGGGCGGGGCGGGG + Intronic
930411061 2:51027463-51027485 GACCCACGGGGGCCGGGGCCTGG - Intronic
930583838 2:53246341-53246363 TACACCCGGTGGGAGGGGCGGGG + Intergenic
931670460 2:64642711-64642733 GACCCTGGGTTGGGGGGGCAGGG + Intronic
932570634 2:72936563-72936585 GGCCTGCGGGGGGCGGGGCGGGG + Intergenic
938392459 2:130916388-130916410 GACCCTCGGTGGTCGGGGCCGGG - Intronic
940004606 2:148999244-148999266 GACCCTGGGTGGGGTGGGGGTGG - Intronic
941476220 2:165954027-165954049 GACAGTGGGTGGGCGGGCCGAGG + Intergenic
944969612 2:204977517-204977539 GAGCCTTGGTAGGCCGGGCGCGG + Intronic
946089705 2:217209995-217210017 GAACCTTGGTGGGCCAGGCGGGG + Intergenic
946427835 2:219608781-219608803 GGCCCACGGTGAGTGGGGCGTGG + Exonic
948684270 2:239660188-239660210 GAGCCTGCGTGGGAGGGGCGGGG - Intergenic
949004287 2:241636821-241636843 GGGCCTCGGCGGCCGGGGCGCGG - Intronic
949067631 2:242003082-242003104 GACCCTCCGTTGCCGGGGCCTGG - Intergenic
1168831402 20:847048-847070 GCCCCACGGTGGGCGTGGAGAGG + Intronic
1169109082 20:3020386-3020408 GCTCCTCTGTGGGCCGGGCGTGG - Intronic
1169136716 20:3202242-3202264 AACCCTCTCTGGGCCGGGCGTGG - Intronic
1169278515 20:4248968-4248990 GGCCGTCGGTGGCCGGGCCGGGG + Exonic
1170810149 20:19667923-19667945 GAGCCTCGGTGCTCAGGGCGAGG - Intronic
1171452822 20:25248001-25248023 GGGCCTCGGGGGGCGGGGCGGGG - Intergenic
1172144071 20:32744007-32744029 GATCCTCTGGGGGCGGGGCCCGG - Intergenic
1172218772 20:33257451-33257473 GACCCTCGGGAAGCTGGGCGAGG - Intergenic
1172320932 20:33994465-33994487 GCCCCTCGCCGGGCGGGGCGGGG - Intronic
1174586790 20:51615083-51615105 GTGCCTGGGGGGGCGGGGCGGGG + Intronic
1175284781 20:57830746-57830768 GACCCTCGCTGGGCAGGATGAGG + Intergenic
1175715059 20:61249841-61249863 GACCAGAGGTGGGCGTGGCGGGG + Intergenic
1175730488 20:61350538-61350560 GACCCTGGGTGGGAGAGGCAAGG - Intronic
1175800712 20:61799744-61799766 GCTCCTGGGTGGGCAGGGCGTGG + Intronic
1175847030 20:62064847-62064869 GGCCCCCGGCGGCCGGGGCGGGG + Exonic
1175927137 20:62476374-62476396 GTCCATCGGTGAGCGGGGCCGGG - Intergenic
1178351088 21:31873495-31873517 GCGCCTCGCTGGGCGGCGCGGGG + Exonic
1180160479 21:45996898-45996920 GACCCTCTGTGGGCTGAGCCTGG - Intronic
1180201591 21:46228040-46228062 TTCCCTCGGTGGCCGGGGCTCGG + Intronic
1181064605 22:20299539-20299561 GCCCTACGGCGGGCGGGGCGGGG + Intergenic
1181161937 22:20964827-20964849 AACCATCTGTGGGCGGGGTGGGG - Intergenic
1181478070 22:23180767-23180789 GGCGCTCGGCGCGCGGGGCGGGG - Exonic
1181681285 22:24497509-24497531 GACCCTGGGTGGGAGAGGTGGGG + Intronic
1183713663 22:39521084-39521106 GGCGGGCGGTGGGCGGGGCGCGG + Exonic
1183966983 22:41447823-41447845 GCCCCTCGGGCGGCGGAGCGAGG + Intergenic
1184231416 22:43160177-43160199 GACCCTGGCTGGGCAGGGCCTGG - Intronic
1184276550 22:43412163-43412185 GACCGGAGGCGGGCGGGGCGCGG + Intronic
1184472136 22:44702143-44702165 GCGCCCCGGGGGGCGGGGCGGGG - Intronic
1184738082 22:46410802-46410824 CAGCCTGGGTGGGCGGGGCTTGG - Intronic
1185403035 22:50628173-50628195 GACCCTTGCGGGGCGGGGCCGGG + Intronic
1185417827 22:50719951-50719973 GACCCGTGGTGGGCGGGGAATGG - Intergenic
949826129 3:8167893-8167915 GACCCTGGGTGGCCAGGGGGAGG - Intergenic
950316213 3:12004268-12004290 TGCCCTCCGTGAGCGGGGCGGGG + Intergenic
950467452 3:13163612-13163634 TACCCTCGGTTGGTGGGGCGAGG + Intergenic
952942669 3:38455457-38455479 AACCCTCGAGGGGCGGGGCCGGG + Intronic
953518845 3:43622137-43622159 GAACTGCGGTGGGAGGGGCGGGG + Intronic
953698132 3:45175635-45175657 GACCCTCTGTGAGCTGGGCTAGG + Intergenic
953912110 3:46898465-46898487 TACTTTAGGTGGGCGGGGCGGGG + Exonic
954259715 3:49429712-49429734 GAACTTCAGTGGGAGGGGCGCGG - Intergenic
957555502 3:81761237-81761259 GAACCTGAGTGGGCGGGGCTCGG - Intronic
959256824 3:104025768-104025790 GAGACTCGGTGGCGGGGGCGCGG + Intergenic
960036704 3:113109440-113109462 GACCCTGGGGGGGCGGTGCATGG - Intergenic
960641904 3:119833123-119833145 GACCATTTGTGGGCGGGGGGTGG - Intronic
961754736 3:129121232-129121254 CTCCCTCGGAGGGTGGGGCGGGG - Intronic
961792291 3:129384896-129384918 GACCCTCGGCGGGGGGCGGGGGG - Intergenic
961827600 3:129606916-129606938 GACCCGCGGACGGCGGGGCGTGG - Intergenic
963091401 3:141486933-141486955 GGGCCGCGGCGGGCGGGGCGGGG + Intergenic
965928132 3:174008355-174008377 GCTCCTCCGTGGGCGGGGGGTGG - Intronic
968415810 4:432758-432780 GGACCTCGGGGGGCGGGGCGGGG - Intronic
968799391 4:2732274-2732296 CACCCTAGGCGGGCTGGGCGGGG + Exonic
968952384 4:3701762-3701784 GGCCCTCCGTGGGAGGGGCTGGG - Intergenic
968961571 4:3747761-3747783 CACTCTCGGGGGTCGGGGCGGGG - Intergenic
969295652 4:6269577-6269599 GACGTTCCGCGGGCGGGGCGGGG + Intergenic
969344055 4:6560232-6560254 GAGCCTGGGTGGGCTGGGCCTGG - Intronic
969732376 4:8964553-8964575 GCCCCACTGGGGGCGGGGCGAGG + Intergenic
969829197 4:9781576-9781598 GAGGCTCGGGGGGCGGGACGCGG + Intronic
972979514 4:44678628-44678650 GACCCTCGTGGGTCGGGGCTGGG + Exonic
977536554 4:98261365-98261387 GAGCGGCGGGGGGCGGGGCGGGG - Intronic
977689929 4:99894570-99894592 GGCCCGCGGTGGGCGGGGGAGGG - Intergenic
977705663 4:100067476-100067498 GGCCCTCAGTGGGCTGGGCGCGG - Intergenic
978884375 4:113749256-113749278 GACACTGGGTGGGGGGGGCGGGG - Intronic
979349617 4:119628836-119628858 GAACCGCGCGGGGCGGGGCGGGG - Exonic
980698779 4:136395592-136395614 AACCCTCGGCGGGCGGGGCGGGG - Intergenic
982198446 4:152937468-152937490 GCCCCTCGGGGAGGGGGGCGGGG + Intronic
982758284 4:159250862-159250884 GCCCCTCTCTGGGCTGGGCGTGG + Intronic
984727559 4:183036182-183036204 GTCCCTGGGTGGGAGGGGCTGGG + Intergenic
984853445 4:184173193-184173215 AACCCTCGATAGGCCGGGCGCGG - Intronic
985660566 5:1155084-1155106 GGGCCTGGGAGGGCGGGGCGGGG - Intergenic
985672815 5:1214872-1214894 GGCCCTGGGTGTGAGGGGCGGGG + Intronic
986404955 5:7416355-7416377 GCCCCTTGGAGGGCTGGGCGCGG + Intronic
987763188 5:22191852-22191874 GACCATTGGTGGGCCGGGCGCGG - Intronic
993168384 5:84384661-84384683 GAGGCGCGGCGGGCGGGGCGCGG + Exonic
1001483272 5:172102916-172102938 GATTCTGGGTGGGGGGGGCGGGG + Intronic
1001602798 5:172939898-172939920 AGCCCTCGGAGGGCGGGGTGGGG + Intronic
1002888628 6:1316470-1316492 CACACTGGGCGGGCGGGGCGGGG + Intergenic
1004203971 6:13574570-13574592 GCACCCCGGGGGGCGGGGCGTGG + Intronic
1006007767 6:31016732-31016754 GACCCTCTCTGGGCTGGCCGAGG + Intronic
1006071304 6:31499412-31499434 GACCTTCAGTGGCGGGGGCGGGG - Intronic
1006124093 6:31826692-31826714 GACCCTGGGAGGGAGGTGCGGGG - Intergenic
1006641078 6:35490214-35490236 CTCCCGCGGGGGGCGGGGCGGGG - Intronic
1009739232 6:67722993-67723015 GACCCTCTCTGGGCTGGCCGAGG + Intergenic
1012875463 6:104720927-104720949 GAGCGTCGCTGGGCCGGGCGCGG - Intergenic
1018046184 6:159968860-159968882 GCCTCTCGGCGGGCTGGGCGCGG - Intergenic
1018330358 6:162720738-162720760 GACCATCTATGGGCCGGGCGCGG - Intronic
1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG + Intronic
1019164025 6:170087371-170087393 GCCCCGCGGTGGGAGGAGCGTGG + Intergenic
1019519837 7:1455625-1455647 GACCCCGGGTGGAGGGGGCGGGG - Intronic
1019536295 7:1531251-1531273 CACCTGCGGGGGGCGGGGCGGGG + Intronic
1019643405 7:2116508-2116530 GACCCCAGGTGGGCAGGGCCTGG + Intronic
1019673685 7:2297879-2297901 GACCCTCAGAGGGCGGGAGGGGG + Intronic
1019708278 7:2506856-2506878 GAACCTGGGAGGGAGGGGCGAGG + Intergenic
1020308912 7:6854893-6854915 GCCCCACTGGGGGCGGGGCGAGG - Intergenic
1022230995 7:28411543-28411565 AACCCTCGGTGTGGGGGGTGGGG + Intronic
1022716221 7:32901169-32901191 GGCCCTCGGTAGGCCGGGCATGG + Intergenic
1023064844 7:36367026-36367048 GGGCCTCGGTGGCGGGGGCGCGG + Intronic
1024639440 7:51317083-51317105 GACCCTCTCTGGGCGGAGTGGGG + Intergenic
1025779002 7:64582758-64582780 GGGCCTCGGCGGGCAGGGCGCGG - Intergenic
1029276770 7:99409756-99409778 GAGGCTCTGTGGGCGGGGGGGGG + Intronic
1029477358 7:100792819-100792841 GACCCTGGATGGGCTGGGCGTGG + Intronic
1029903989 7:104072036-104072058 AGCCCACGGTGGGTGGGGCGGGG - Intergenic
1033306175 7:140227442-140227464 GGCCCCCGCTGGGCTGGGCGTGG + Intergenic
1038540343 8:28385857-28385879 GGGCCGCGGCGGGCGGGGCGCGG - Intronic
1040981768 8:53251763-53251785 GACTCCGGGCGGGCGGGGCGGGG - Intergenic
1043542582 8:81280426-81280448 GGCGCCCGGCGGGCGGGGCGGGG + Exonic
1047498862 8:125427466-125427488 GCCCCTGGGTGGGCGGAGCTGGG + Intergenic
1049180859 8:141221452-141221474 GACCCTCTGTGGGCCTGGCTGGG - Intronic
1049707687 8:144050501-144050523 GGCGCGCGGTGGGCGGGGCCGGG - Intergenic
1049761300 8:144333027-144333049 GGCCCCTGGCGGGCGGGGCGGGG + Exonic
1049803740 8:144529847-144529869 GGCTCTCGGTGGGTGGGGTGGGG - Exonic
1049944227 9:579194-579216 GACCCAGGGTGGGTGGGTCGGGG - Intronic
1049961932 9:745203-745225 GAACCTCGGTGGGTGGGGCCAGG - Exonic
1052218653 9:25995515-25995537 GCTCCTCGGGGGGCGGGGGGCGG - Intergenic
1053072886 9:35111488-35111510 GACCGTCGCAGGGAGGGGCGCGG - Exonic
1053166315 9:35846374-35846396 GGGCCTCGGTGAGCGGTGCGGGG + Exonic
1055757844 9:79573444-79573466 AACCCTCGGGGTCCGGGGCGCGG + Intronic
1057222259 9:93263731-93263753 GAACGTGAGTGGGCGGGGCGTGG + Exonic
1059441427 9:114309197-114309219 AACCCTCGGTGTGGGGGGTGTGG + Intronic
1061521910 9:131123421-131123443 GAACCTCTGTCGGCCGGGCGCGG + Intergenic
1061962126 9:133993512-133993534 CACCCTGGGTGGTGGGGGCGCGG + Intergenic
1062335924 9:136067545-136067567 GATGCTCGATGGGCCGGGCGCGG + Intronic
1062363197 9:136197262-136197284 GCCCCTGGGTGGGCGGCTCGGGG - Exonic
1062390903 9:136333480-136333502 GTCCCTCGGTGAGCAGGGCTAGG + Intronic
1062499768 9:136847407-136847429 GGCCCTGGGTGGGCCGGGCGGGG - Exonic
1186432918 X:9520311-9520333 GTCCCTCGGTGGGGGGCGGGGGG - Intronic
1189234280 X:39475702-39475724 AACCCTCGGTGGGGGTGGGGTGG + Intergenic
1189262751 X:39689584-39689606 GCCCCTCGGTGGGGGTGGAGGGG + Intergenic
1189821397 X:44873021-44873043 CGGCCTCGGTGGGCGGGGCTCGG + Intergenic
1190319462 X:49171782-49171804 TATCCTTGGGGGGCGGGGCGAGG + Intergenic
1197050138 X:122047339-122047361 GATCCTCGGTGGGGGGAGGGGGG + Intergenic
1198398982 X:136251440-136251462 GGCTGCCGGTGGGCGGGGCGGGG + Exonic
1199736928 X:150693706-150693728 GGCCCTCGGGAGTCGGGGCGCGG - Intronic