ID: 1096073927

View in Genome Browser
Species Human (GRCh38)
Location 12:48790098-48790120
Sequence TTTCACTCCAGGATGTACGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096073920_1096073927 22 Left 1096073920 12:48790053-48790075 CCCTTTGAGGATTAGAGTAATGG 0: 1
1: 0
2: 0
3: 4
4: 142
Right 1096073927 12:48790098-48790120 TTTCACTCCAGGATGTACGTAGG 0: 1
1: 0
2: 0
3: 5
4: 57
1096073922_1096073927 21 Left 1096073922 12:48790054-48790076 CCTTTGAGGATTAGAGTAATGGT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1096073927 12:48790098-48790120 TTTCACTCCAGGATGTACGTAGG 0: 1
1: 0
2: 0
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096073927 Original CRISPR TTTCACTCCAGGATGTACGT AGG Intergenic
904280821 1:29417124-29417146 TATCACCCCAGGATATAGGTGGG + Intergenic
915509701 1:156379863-156379885 TCTCCCTCCAGGATGGACCTGGG + Intronic
922023903 1:221732870-221732892 TTTCACTGCAGGCTGTTCATTGG - Intronic
922056592 1:222048157-222048179 TTTCCCTCCAGGATGCACATAGG + Intergenic
1074058830 10:109946284-109946306 TTTCTCTCCAGGATGGAAGTGGG - Intronic
1083252478 11:61477392-61477414 TTTCACTCCCGGCTCTACGTGGG - Intronic
1085033157 11:73284803-73284825 TTTCACTGCTGCATGTACTTAGG - Intronic
1085279273 11:75319702-75319724 TGTCAGGCCAGGATGTACGCTGG + Intronic
1087840845 11:102919577-102919599 TTTCACTCCAGCCTGTATGATGG - Intergenic
1092006674 12:5076096-5076118 TTCCACTCCAGGATGTGAGTGGG + Intergenic
1094251520 12:28367841-28367863 TTTCCCTCCATAATGTAGGTGGG + Intronic
1096073927 12:48790098-48790120 TTTCACTCCAGGATGTACGTAGG + Intergenic
1101963177 12:109265104-109265126 TTCCACTCCAGGATGTCCTGTGG - Exonic
1117649677 14:57890231-57890253 TTTGTCTCCAGGATGTGAGTGGG - Intronic
1120268129 14:82277044-82277066 TTTCTCTCCATGATTTACTTGGG + Intergenic
1120269292 14:82290612-82290634 TTTCTCTCCATGATTTACTTGGG - Intergenic
1120544077 14:85788546-85788568 TTTCACTGGAGAATGTAGGTTGG - Intergenic
1120603175 14:86537869-86537891 TTTCTCTCCAGGATTTGCATGGG - Intergenic
1120629329 14:86870785-86870807 TTCCACTTCAGAATGTAGGTGGG - Intergenic
1121099284 14:91238985-91239007 TTTCTCTCCAAAATGAACGTAGG - Intronic
1124824341 15:33078783-33078805 TCTCTCTCCAGGATGAAGGTGGG - Intronic
1126114207 15:45194209-45194231 ATTCACTCCATGATGGAGGTTGG - Intronic
1126307067 15:47271939-47271961 TTTCTTTCCAGGATGTATTTTGG + Intronic
1130241815 15:82200586-82200608 TTTCAGTCCAGGACATACCTGGG + Intronic
1130458613 15:84140576-84140598 TTTCAGTCCAGGACATACCTGGG - Intergenic
1137345434 16:47653655-47653677 TCCCATTCCAGGATGTACCTAGG + Intronic
1141315822 16:82961690-82961712 TCTCATTCCTGGCTGTACGTTGG - Intronic
1147291581 17:39447824-39447846 TTTCACTCCAGGGTCTATTTTGG + Exonic
1157329390 18:46692438-46692460 TTGCACTCCAGCCTGTACATCGG - Intronic
925902259 2:8517051-8517073 CTTTACTCCAGGCTGTACGCGGG - Intergenic
929696685 2:44122968-44122990 TTTCACTTAAGAATGTACTTGGG - Intergenic
933874928 2:86609941-86609963 TTTCAATGCAGGGTGTAAGTGGG - Intronic
933949079 2:87313052-87313074 TTTCACTTAAGGATTTAGGTGGG - Intergenic
936331118 2:111548545-111548567 TTTCACTTAAGGATTTAGGTGGG + Intergenic
942379808 2:175376989-175377011 TTGCAGTCCAGGATGTTTGTGGG - Intergenic
945548205 2:211184853-211184875 TTTCACTCCCCAATGTAAGTGGG - Intergenic
946111222 2:217419493-217419515 TTTCACTCCAGAATGTCCTTTGG + Intronic
1171003384 20:21438269-21438291 TTACTCTCCATAATGTACGTGGG + Intergenic
1182527186 22:30927776-30927798 TCTCAAACCAGGTTGTACGTCGG + Intronic
1183241112 22:36659003-36659025 TTTCACTCCAGCATGTGGCTTGG + Intronic
949612280 3:5715183-5715205 TTACACTCCAAGCTGTACTTGGG - Intergenic
955799611 3:62672107-62672129 TTTCAATCCTGGCTGCACGTTGG - Intronic
959420440 3:106121644-106121666 TTTCCCTCCAGGATAAAAGTTGG + Intergenic
960872918 3:122268006-122268028 TTTCACTCCTGCATGTGAGTAGG + Intronic
961221610 3:125205404-125205426 TTTCACTCCAGTTTCTAGGTGGG + Intronic
963295861 3:143545727-143545749 TTTCACTCCAGTATGAACCAGGG + Intronic
965825880 3:172729388-172729410 TTTCATTCCTAGATGTACTTTGG - Intergenic
966150307 3:176861033-176861055 TTCCCCTCCAGAATGTATGTAGG - Intergenic
976665870 4:87590794-87590816 TTACACTGGAGGATGTACATAGG + Intergenic
986686835 5:10282188-10282210 TTCCACTCAAGGACGTAAGTTGG - Exonic
987568902 5:19629971-19629993 TTGCACTCCAGCCTGTACGATGG - Intronic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
1023142228 7:37113078-37113100 TTTCACTCCAGGACGGACAAAGG + Intronic
1023867028 7:44243174-44243196 GCACACTCCAGGATGTAGGTGGG + Intronic
1032467565 7:132155890-132155912 TTTCTCTCCATAATGTAGGTGGG + Intronic
1037018318 8:13936421-13936443 TTTGACTCCAGGAGTTAGGTTGG - Intergenic
1041415591 8:57604645-57604667 TTTCTCTCAAGTATGTACATAGG + Intergenic
1044004516 8:86925217-86925239 TCTCGCTCCAGGATATAAGTTGG - Intronic
1056057378 9:82840935-82840957 TTTCACTTCAGGGTGTCCTTAGG + Intergenic
1060308855 9:122440931-122440953 TTCTACTCCAGGAAGTACATTGG - Intergenic
1189921606 X:45908348-45908370 CTGCACTCCAGGCTGGACGTGGG - Intergenic
1190627923 X:52354471-52354493 TTACACTCCATGATGTGGGTTGG + Intergenic
1195685580 X:107582009-107582031 TTTCTCTCCAGTATATACCTAGG + Intronic