ID: 1096076901

View in Genome Browser
Species Human (GRCh38)
Location 12:48811568-48811590
Sequence GTGCATCAGCAGACCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 350}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096076897_1096076901 7 Left 1096076897 12:48811538-48811560 CCGTTCTGTGAGACTGGAATCAC 0: 1
1: 0
2: 1
3: 17
4: 177
Right 1096076901 12:48811568-48811590 GTGCATCAGCAGACCCAGAGGGG 0: 1
1: 0
2: 2
3: 29
4: 350
1096076895_1096076901 30 Left 1096076895 12:48811515-48811537 CCAGGCTCATTGCTCACTGCAAT 0: 1
1: 0
2: 4
3: 24
4: 273
Right 1096076901 12:48811568-48811590 GTGCATCAGCAGACCCAGAGGGG 0: 1
1: 0
2: 2
3: 29
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096076901 Original CRISPR GTGCATCAGCAGACCCAGAG GGG Intergenic
900881116 1:5381999-5382021 GTGCATCAGGAGACTCAGAAAGG + Intergenic
901777419 1:11569899-11569921 GAGCATCAGCGGAACCAGGGAGG + Intergenic
902836291 1:19048926-19048948 GTGCTTCAGGAGACCGAGACCGG + Intergenic
903647157 1:24902487-24902509 GAGCATCAGCAGCCTCAGCGTGG - Exonic
905649816 1:39648625-39648647 AAGCTGCAGCAGACCCAGAGGGG + Intergenic
905956634 1:42002627-42002649 TTCCATCAGCAGATCCAGTGGGG + Intronic
908534438 1:65065820-65065842 TTCCATTAGAAGACCCAGAGGGG + Intergenic
916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG + Intronic
917166512 1:172118742-172118764 AGGCATCAGGAGAGCCAGAGTGG + Intronic
917614164 1:176721040-176721062 GTGAGTCAGCAGACTGAGAGAGG - Intronic
918199926 1:182257589-182257611 GTGAGTCAGGAGACTCAGAGTGG - Intergenic
920269329 1:204751543-204751565 GTGCTTCAGAAGACCCCCAGTGG + Intergenic
922080642 1:222292554-222292576 GTAGATCAGCAGACACAGAAAGG + Intergenic
1066991652 10:42520237-42520259 GTGCATCAGAAAACACACAGGGG - Intergenic
1071547142 10:86537346-86537368 CTGCATCAGGAGACCCACTGCGG - Intergenic
1072047215 10:91669115-91669137 GTGCAAAAGCATTCCCAGAGAGG - Intergenic
1072899107 10:99391818-99391840 GAGCATCAGGGGTCCCAGAGTGG - Exonic
1073068198 10:100776625-100776647 CTGCATCAGCAGGCACACAGAGG - Intronic
1073678219 10:105673619-105673641 GAGCATCAAGTGACCCAGAGAGG - Intergenic
1074665248 10:115715028-115715050 GAGCATCATTAGACCAAGAGAGG + Intronic
1075453944 10:122572714-122572736 TTGCATCAGCAGGCTCTGAGGGG - Intronic
1076509264 10:131000489-131000511 CTGGATCAGGAGGCCCAGAGAGG - Intergenic
1076753625 10:132556289-132556311 ATGCATCCACAGACCCACAGTGG + Intronic
1078447255 11:11413624-11413646 GTGCAGCCACAGACCCAGAGTGG - Intronic
1080055503 11:27902426-27902448 GTCCACCAGCAGACCCACAGAGG - Intergenic
1081980711 11:47264879-47264901 GGGCATCAGCAGACCCTCAGAGG + Intronic
1084259435 11:67965963-67965985 GTCCATCAGCTGGGCCAGAGGGG + Intergenic
1084810819 11:71610034-71610056 GTGAATCATCATATCCAGAGGGG - Intergenic
1085412274 11:76298308-76298330 GGCCATCAGAGGACCCAGAGAGG + Intergenic
1085835176 11:79948115-79948137 ATGAAACAGCAGACCCAGACAGG - Intergenic
1087474919 11:98622949-98622971 TGGCATCAGCAGACACAGAGTGG - Intergenic
1088537290 11:110875153-110875175 TGGCATCAGCAATCCCAGAGAGG + Intergenic
1091353921 11:134921023-134921045 GCGCTTCAGCAGCCTCAGAGGGG + Intergenic
1095840752 12:46689271-46689293 GTGCATCAACATACCCATACTGG + Intergenic
1096076901 12:48811568-48811590 GTGCATCAGCAGACCCAGAGGGG + Intergenic
1099932891 12:89093818-89093840 GTCAATCAGCAGAGACAGAGAGG + Intergenic
1101340895 12:103841189-103841211 GGGCAGCAGCAGTCGCAGAGCGG - Exonic
1102035684 12:109769383-109769405 GGGCATCAGCAGGCACAGGGTGG - Exonic
1102386909 12:112517491-112517513 GTGCATCAGCAGCCTCAGCCTGG + Intergenic
1102733564 12:115136920-115136942 GTCCCTCTGCAGTCCCAGAGGGG + Intergenic
1103189880 12:118992338-118992360 GTGCCACAGGAGACCCTGAGGGG - Intronic
1103604531 12:122077371-122077393 GGGCATCAGAAGAGCCAGTGAGG - Intergenic
1104344772 12:127986016-127986038 GTGCATTAACAGGCTCAGAGAGG - Intergenic
1104386861 12:128358096-128358118 GTGCAGCTCCAGCCCCAGAGGGG - Intronic
1104583631 12:130029574-130029596 GGGCATTTGCAGACTCAGAGTGG - Intergenic
1104888576 12:132127167-132127189 GTGCAGCAGCAGGCCTGGAGCGG - Intronic
1104930792 12:132338454-132338476 GTGCACCAGCAGACCCCACGAGG + Intergenic
1105931576 13:25057454-25057476 GAGCATCTGCAGATCCAAAGAGG + Intergenic
1108595838 13:51948393-51948415 GTGCATCACCACACCCAGTATGG + Intronic
1111735590 13:92135050-92135072 CTGCAGCAGGAGAACCAGAGAGG - Intronic
1112273771 13:97996331-97996353 GTGCACCAGCAGGCCCAGTCAGG + Intronic
1113955259 13:114096974-114096996 GTGGAGGAGCAGACTCAGAGTGG - Intronic
1119679207 14:76579319-76579341 ATGCATCATCAGACCCAGCATGG + Intergenic
1122014372 14:98781579-98781601 GAGCAGCATTAGACCCAGAGTGG + Intergenic
1122424772 14:101599464-101599486 ATTCATCAGCACACCCAGTGAGG + Intergenic
1123675190 15:22703730-22703752 CTGTAGCAGGAGACCCAGAGAGG - Intergenic
1129691498 15:77716426-77716448 GTGCACCAGCACACCCAGCCGGG + Intronic
1129772645 15:78212684-78212706 GAGCCACAGCAGCCCCAGAGAGG + Intronic
1130244458 15:82231945-82231967 GTGTTTCAGCACACCCAGAACGG + Intronic
1130515305 15:84621750-84621772 GTGCACCAGCGGACCCACACGGG + Exonic
1130871679 15:87976881-87976903 GTGCACCAGCAAAGCCAGTGGGG - Intronic
1131789548 15:95949207-95949229 GTGCTTCAGAAGACTAAGAGAGG + Intergenic
1132032858 15:98452524-98452546 CTGCTGCAGCAGAGCCAGAGAGG + Intronic
1133602417 16:7352317-7352339 GGTCATCATCAGGCCCAGAGTGG - Intronic
1135165385 16:20134477-20134499 GTGGAGCAGCAGATCCAGATTGG + Intergenic
1137699786 16:50489203-50489225 TGGCACCAGCAGCCCCAGAGGGG - Intergenic
1138958113 16:61995895-61995917 GTGGTTCAGAAGACCAAGAGTGG - Intronic
1139421520 16:66852126-66852148 TTGCATCAGTGGACACAGAGAGG + Intronic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141948018 16:87323568-87323590 GTTCATCAGCAGAGCCAGGCAGG + Intronic
1142776696 17:2145682-2145704 TTGCATCAGAAGCCACAGAGAGG + Intronic
1143037209 17:4006246-4006268 GTGCATGAGCAGACGTACAGGGG + Exonic
1145005829 17:19337241-19337263 GTGCAACAGCTGACCGACAGAGG + Intergenic
1146656351 17:34637421-34637443 GTGCACCCGCAGGCCCACAGGGG - Exonic
1147193656 17:38750894-38750916 GTGCATCAGAAGAGTCACAGTGG + Exonic
1147403618 17:40195350-40195372 GTGCATCAGCAGTAGCAGGGAGG - Exonic
1147964826 17:44188980-44189002 CAGCATCAGCAGAGCCTGAGGGG - Intronic
1148108244 17:45130757-45130779 GGGCATCAGGAGCCCCAGAAAGG - Intronic
1148835760 17:50464943-50464965 GTGCATCAGCAGAGGCTGTGGGG + Exonic
1149232589 17:54553053-54553075 GTGCATGTACAGACCCAGCGTGG + Intergenic
1150442287 17:65201296-65201318 GAGCATCACCTGAGCCAGAGGGG - Intronic
1150486642 17:65548630-65548652 TTGGTTCAGGAGACCCAGAGTGG - Intronic
1151390470 17:73783775-73783797 CTGAATTAGGAGACCCAGAGGGG + Intergenic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1160133605 18:76251918-76251940 GTGCTGCAACAGTCCCAGAGTGG - Intergenic
1164063592 19:21695429-21695451 GTGCATGAGCAGAGCCATGGAGG + Intergenic
1164130568 19:22357832-22357854 GAGCATCAGAAGACCCATAAGGG + Intergenic
1167970181 19:53184411-53184433 GTTCCCCAGCAGACCCAGGGTGG - Intronic
1168351653 19:55679549-55679571 GTGCACCAAGACACCCAGAGCGG - Intronic
925780988 2:7381829-7381851 GTGCATCTGCAGAGAAAGAGAGG + Intergenic
926590524 2:14735415-14735437 AAGCATCAGCAGAGCCAGAATGG - Intergenic
927214767 2:20662055-20662077 CATCATCACCAGACCCAGAGAGG + Intergenic
927684845 2:25163245-25163267 GTGAAACAGGAGACTCAGAGAGG + Intronic
928606397 2:32947751-32947773 GTGCCGCAGGAGACCCAGAGCGG + Exonic
929061247 2:37926193-37926215 CTTCATCAGCAGACCCTTAGAGG - Intronic
931378121 2:61726393-61726415 GTGAACAAGCAAACCCAGAGAGG + Intergenic
932819556 2:74887795-74887817 GTGCATCAGCAGTGGCAGACAGG - Intronic
934710686 2:96512123-96512145 GGGCATCTGCAGCCCCAGACAGG + Intergenic
941187844 2:162339681-162339703 GTGCATGAGGATAGCCAGAGAGG - Intronic
943436004 2:187866754-187866776 GTGGATCTGCAGACCTGGAGAGG - Intergenic
943436094 2:187867404-187867426 GTGCAGCTGGAGACCCGGAGAGG - Intergenic
943436201 2:187868147-187868169 GTGCAGCTGGAGACCCAGAGAGG - Intergenic
943436222 2:187868291-187868313 GTGCAGCTGGAGACCCGGAGAGG - Intergenic
943436235 2:187868391-187868413 GTGCAGCTGGAGACCCAGAGAGG - Intergenic
943436253 2:187868538-187868560 ATGCAGCTGGAGACCCAGAGAGG - Intergenic
943436278 2:187868735-187868757 CTGCAGCTGGAGACCCAGAGAGG - Intergenic
943436293 2:187868829-187868851 CTGCAGCTGGAGACCCAGAGAGG - Intergenic
943436327 2:187869072-187869094 TTGCAGCTGGAGACCCAGAGAGG - Intergenic
943437239 2:187881350-187881372 GTGCTTCAGGAGAGGCAGAGGGG - Intergenic
943672619 2:190679827-190679849 GTTCATCAGCAGAATCTGAGTGG - Intronic
945444814 2:209924454-209924476 GTGCCTCAACACACCCAAAGTGG - Intronic
949070318 2:242020560-242020582 CTGCAGCTGCAGACCCAGAGAGG + Intergenic
1168792896 20:591921-591943 GTGAACCACCACACCCAGAGAGG + Intergenic
1169994842 20:11545232-11545254 GTGCCTCAGCTGACCCATCGAGG + Intergenic
1171015129 20:21533871-21533893 GTTCATCAGCTGGCCCAGATAGG + Intergenic
1172526755 20:35604427-35604449 CTGAATCGGCAGATCCAGAGTGG + Intergenic
1173713251 20:45178938-45178960 GTGCCACAGCAGATCCTGAGGGG - Intergenic
1173884686 20:46446792-46446814 GTGTACCAGAAAACCCAGAGGGG - Intergenic
1174061086 20:47833586-47833608 GTGGATCTGGAGACCCAGGGTGG + Intergenic
1174061273 20:47834664-47834686 GTGAAACAGAAGACCCAGGGAGG - Intergenic
1174070252 20:47894659-47894681 GTGAAACAGAAGACCCAGAAAGG + Intergenic
1174070284 20:47894862-47894884 GTGGAGCTGCAGACCCAGGGAGG + Intergenic
1174070317 20:47895055-47895077 GTGGAGCTGCAGACCCAGGGAGG + Intergenic
1174070393 20:47895447-47895469 GTGGAGCTGCAGACCCAGGGAGG + Intergenic
1174070432 20:47895643-47895665 GTGGAGCCGCAGACCCAGGGAGG + Intergenic
1174070464 20:47895839-47895861 GTGGAGCTGCAGACCCAGGGAGG + Intergenic
1174070503 20:47896035-47896057 GTGGAGCTGCAGACCCAGGGAGG + Intergenic
1174070690 20:47897113-47897135 GTGGATCTGGAGACCCAGGGTGG - Intergenic
1174100809 20:48124895-48124917 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174100853 20:48125178-48125200 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174100879 20:48125325-48125347 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174100893 20:48125420-48125442 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174100937 20:48125708-48125730 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174101018 20:48126191-48126213 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174101034 20:48126289-48126311 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174149022 20:48473092-48473114 GTGGAGCTGGAGACCCAGAGAGG - Intergenic
1174153369 20:48501543-48501565 GTGGATCTGGAGACCCAGGGTGG + Intergenic
1174153836 20:48504207-48504229 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174153868 20:48504402-48504424 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174153908 20:48504599-48504621 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154053 20:48505382-48505404 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154125 20:48505773-48505795 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154203 20:48506165-48506187 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154236 20:48506360-48506382 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154307 20:48506753-48506775 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154327 20:48506851-48506873 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154366 20:48507049-48507071 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154516 20:48507835-48507857 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154555 20:48508031-48508053 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154588 20:48508226-48508248 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154609 20:48508325-48508347 GTGGAGCTGCCGACCCAGAGAGG - Intergenic
1174154751 20:48509108-48509130 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154827 20:48509500-48509522 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154861 20:48509695-48509717 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154899 20:48509892-48509914 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155096 20:48510968-48510990 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155135 20:48511165-48511187 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155226 20:48511654-48511676 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155247 20:48511754-48511776 GTGGATCTGCCGACCCAGGGAGG - Intergenic
1174155265 20:48511852-48511874 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155303 20:48512049-48512071 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155470 20:48512930-48512952 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155501 20:48513125-48513147 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155540 20:48513322-48513344 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155656 20:48513910-48513932 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155688 20:48514105-48514127 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155726 20:48514302-48514324 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155882 20:48515130-48515152 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155916 20:48515325-48515347 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155956 20:48515522-48515544 GTGGAGCTGCAGACCCAGGGAGG - Intergenic
1174156142 20:48516567-48516589 GTGAAACAGAAGACCCAGAAAGG - Intergenic
1175903572 20:62369285-62369307 GTGCACCAGCAGACACAGGGTGG - Intergenic
1177893836 21:26838204-26838226 GTGAAACAGCGGAACCAGAGGGG - Exonic
1179479579 21:41668924-41668946 CTGGCTCAGCAGACCCACAGGGG - Intergenic
1181079796 22:20406246-20406268 GTGCATGAGAAGATCCACAGCGG + Exonic
1181894029 22:26090954-26090976 CTGAAGCAGCAGACCCAGAAGGG - Intergenic
1182777886 22:32844256-32844278 GTTCATCAGCATAAACAGAGTGG - Intronic
1184517277 22:44970464-44970486 CTGTAGCAGCAGACCTAGAGGGG - Intronic
1184968892 22:48001287-48001309 TTGCATCATCAGGTCCAGAGAGG + Intergenic
949158916 3:858044-858066 GTGCAGCTGGAGACCCAGGGAGG - Intergenic
949159153 3:859560-859582 GTGCAGCAGAAGACCCACAGAGG - Intergenic
954335071 3:49911607-49911629 GTGCCTCCTCAGACCCATAGCGG + Exonic
955104697 3:55885917-55885939 GTGAGTCATCAGACCCAGGGTGG - Intronic
957848030 3:85764657-85764679 ATGCATCAGCATATCAAGAGTGG + Intronic
958549700 3:95595899-95595921 GGGCCTCGGCAAACCCAGAGAGG + Intergenic
961168603 3:124780247-124780269 GGGCCTCTGCAGACCCAGAGTGG - Intronic
961410776 3:126718799-126718821 CTGCACCAACAGAACCAGAGGGG - Intronic
961433642 3:126901206-126901228 GTGTAACAGGAGACCCAGGGTGG + Intronic
961602675 3:128073315-128073337 GGGCATCAGCAGGTCCAGGGAGG - Intronic
962444111 3:135449663-135449685 TGGCATCAGCAGACACTGAGAGG - Intergenic
963644454 3:147896201-147896223 GTGCTTCAGGAGAGACAGAGGGG - Intergenic
963765420 3:149330139-149330161 GTGCATCAGTAGAACAAAAGTGG + Intronic
966578423 3:181530169-181530191 GTGCAGCAGCTGTCCCAGTGGGG - Intergenic
968049473 3:195644306-195644328 GTGCAGCTGCAGACCCGGGGAGG + Intergenic
968049481 3:195644353-195644375 GTGCAGCTGCAGACCCGGGGAGG + Intergenic
968049489 3:195644400-195644422 GTGCAGCTGCAGACCCGGGGAGG + Intergenic
968049497 3:195644447-195644469 GTGCAGCTGCAGACCCGGGGAGG + Intergenic
968049505 3:195644494-195644516 GTGCAGCTGCAGACCCGGGGAGG + Intergenic
968049513 3:195644541-195644563 GTGCAGCTGCAGACCCGGGGAGG + Intergenic
968049521 3:195644588-195644610 GTGCAGCTGCAGACCCGGGGAGG + Intergenic
968049529 3:195644635-195644657 GTGCAGCTGCAGACCCGGGGAGG + Intergenic
968049537 3:195644682-195644704 GTGCAGCTGCAGACCCGGGGAGG + Intergenic
968049545 3:195644729-195644751 GTGCAGCTGCAGACCCGGGGAGG + Intergenic
968049643 3:195645532-195645554 TTGCAGCTGCAGACCCGGAGAGG + Intergenic
968049688 3:195645907-195645929 GTGCAGCAGAAGACTCAGGGAGG + Intergenic
968049744 3:195646377-195646399 ATGCAGCTGCAGACCCGGAGAGG + Intergenic
968049815 3:195646917-195646939 GTGCACCTGGAGACCCAGGGAGG + Intergenic
968049880 3:195647245-195647267 GTGCAGCTGGAGACCCAGTGGGG - Intergenic
968050050 3:195648031-195648053 GTGCATCGGGAGACCCGGTGGGG + Intergenic
968097188 3:195940322-195940344 GTGCATCTGGAGACCCGGTGAGG - Intergenic
968097478 3:195941672-195941694 GTGCACCTGGAGACCCAGGGAGG - Intergenic
968097514 3:195941881-195941903 TTGCAGCTGCAGACCCGGAGAGG - Intergenic
968097683 3:195943385-195943407 GTGGAGCTGCAGACCCGGAGAGG - Intergenic
968097736 3:195943763-195943785 TTCCAGCTGCAGACCCAGAGAGG - Intergenic
968097805 3:195944378-195944400 TTGCAGCTGCAGACCCGGAGAGG - Intergenic
968097850 3:195944709-195944731 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968097865 3:195944803-195944825 GTGCACCTGCAGACCCGGGGAGG - Intergenic
968097872 3:195944850-195944872 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968097883 3:195944944-195944966 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968097889 3:195944991-195945013 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968097895 3:195945038-195945060 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968097909 3:195945132-195945154 GTGCACCTGCAGACCCGGGGAGG - Intergenic
968097916 3:195945179-195945201 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968097925 3:195945273-195945295 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968105743 3:196000065-196000087 GTGCAGCTGGAGACCCAGCGGGG - Intergenic
968105750 3:196000111-196000133 GTGCAGCTGGAGACCCAGGGGGG - Intergenic
968105862 3:196000587-196000609 GTGCATCTGGAGACCCGGTGGGG - Intergenic
968106108 3:196002434-196002456 TTGCAGCTGCAGATCCAGAGAGG - Intergenic
968106351 3:196004372-196004394 TTGCAGCTGCAGACCCGGAGAGG - Intergenic
968106394 3:196004700-196004722 CTGCAGCTGCAGACCCGGAGAGG - Intergenic
968303915 3:197637122-197637144 GTTCATCTGGAGACCCAGTGGGG - Intergenic
968304319 3:197639065-197639087 GTGCAGCTGGAGACCCAGGGAGG - Intergenic
968304389 3:197639605-197639627 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968304447 3:197640075-197640097 GTGCAGCAGAAGACTCAGGGAGG - Intergenic
968304492 3:197640450-197640472 TTGCAGCTGCAGACCCGGAGAGG - Intergenic
968304588 3:197641300-197641322 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304643 3:197641817-197641839 GTGCAGCTGCAGACCCGGGGAGG - Intergenic
968304700 3:197642241-197642263 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968304705 3:197642288-197642310 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304719 3:197642382-197642404 GTGCAGCTGCAGACCCGGAGAGG - Intergenic
968304725 3:197642429-197642451 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968304731 3:197642476-197642498 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968304737 3:197642523-197642545 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968304750 3:197642617-197642639 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304763 3:197642711-197642733 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304769 3:197642758-197642780 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968304780 3:197642852-197642874 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304786 3:197642899-197642921 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968304833 3:197643276-197643298 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968304838 3:197643322-197643344 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304851 3:197643416-197643438 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304864 3:197643510-197643532 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304870 3:197643557-197643579 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968304881 3:197643651-197643673 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304894 3:197643745-197643767 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304907 3:197643839-197643861 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304919 3:197643933-197643955 GTGCACCTGCAGACCCGGGGAGG - Intergenic
968304949 3:197644169-197644191 GTGCAGCTGCAGACCCGGGGAGG - Intergenic
968304962 3:197644263-197644285 GTGCAGCTGCAGACCCGGAGAGG - Intergenic
968304968 3:197644310-197644332 GTGCAGCTGCAGACCCGGAGAGG - Intergenic
968304981 3:197644404-197644426 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304994 3:197644498-197644520 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305007 3:197644592-197644614 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305013 3:197644639-197644661 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968305026 3:197644733-197644755 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305032 3:197644780-197644802 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968305045 3:197644874-197644896 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305051 3:197644921-197644943 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968305064 3:197645015-197645037 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305070 3:197645062-197645084 GTGCAGATGCAGACCCGGAGAGG - Intergenic
968305084 3:197645156-197645178 GTGCACCTGCAGACCCGGAGAGG - Intergenic
968305089 3:197645203-197645225 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305095 3:197645250-197645272 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
968305108 3:197645344-197645366 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305114 3:197645391-197645413 GTGCAGCTGCAGACCCGGGGAGG - Intergenic
968305121 3:197645438-197645460 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305127 3:197645485-197645507 GTGCAGCTGCAGACCCGGGGAGG - Intergenic
982548470 4:156765068-156765090 GAGCATCAGCAGACAAAGACAGG - Intronic
983912749 4:173258327-173258349 GTGCACCAGTAGACATAGAGTGG + Intronic
984226275 4:177039115-177039137 CTGGATCAGAAGTCCCAGAGAGG - Intergenic
985506256 5:282449-282471 TTGCAGCTGCAGACCCAGAGAGG + Intronic
985506353 5:283393-283415 TTGCAGCTGCAGACCCAGAGAGG + Intronic
985506357 5:283440-283462 TTGTAGCTGCAGACCCAGAGAGG + Intronic
985506396 5:283815-283837 TTGCAGCTGCAGACCCGGAGAGG + Intronic
985506614 5:285172-285194 GTGCAGCTGGAGACCCAGAGGGG + Intronic
985506836 5:286264-286286 GTGCAGCTGGAGACCCAGCGGGG + Intronic
985606060 5:858621-858643 GTGGCTGAGCAGGCCCAGAGGGG - Intronic
985741146 5:1618173-1618195 GTGCATCTGGAGACCCAGTGGGG - Intergenic
985741180 5:1618341-1618363 GTGCAGCTGGAGACCCAGGGGGG - Intergenic
985741274 5:1618762-1618784 GTGCATCTGGAGACCCGGTGGGG - Intergenic
985741297 5:1618857-1618879 GTGCATCTGGAGACCCGGTGGGG - Intergenic
985741441 5:1619546-1619568 GTGCAGCTGGAGACCCAGCGGGG - Intergenic
985741601 5:1620333-1620355 GTGCACCTGGAGACCCAGGGGGG - Intergenic
985741632 5:1620514-1620536 TTGCAGCTGCAGACCCAGAGAGG - Intergenic
985741656 5:1620746-1620768 TTGCAGCTGCAGACCCGGAGAGG - Intergenic
985741879 5:1622488-1622510 GTGCAGCTGCAGACTCGGAGAGG - Intergenic
985741919 5:1622770-1622792 TTGCAGCTGCAGACCCGGAGAGG - Intergenic
985741931 5:1622911-1622933 GTGCAGCTGCAGACCCGGAGAGG - Intergenic
985741966 5:1623146-1623168 TTGCAGCTGCAGACCCGGAGAGG - Intergenic
985741996 5:1623428-1623450 GTGCAGCTGCAGACTCGGAGAGG - Intergenic
985742007 5:1623523-1623545 GTGCAGCTGCAGACCCGGAGTGG - Intergenic
985742032 5:1623711-1623733 GTGCAGCTGCAGACCCAGAGAGG - Intergenic
985742042 5:1623805-1623827 ATGCAGCTGCAGACCCGGAGAGG - Intergenic
985742177 5:1624769-1624791 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
985742205 5:1625004-1625026 CTGCAGCTGCAGACCCGGAGAGG - Intergenic
985951459 5:3224830-3224852 AAGCATCAGGAGTCCCAGAGTGG + Intergenic
986466946 5:8035075-8035097 GAGGAGCAGGAGACCCAGAGTGG + Intergenic
987465436 5:18266382-18266404 ATGCATAAGCATACCCAGAATGG - Intergenic
987797072 5:22641460-22641482 GTGATTCAGCAGACCAAGTGGGG - Intronic
988065506 5:26225852-26225874 GTGCAGCTTGAGACCCAGAGAGG - Intergenic
988065535 5:26226102-26226124 GTGCACTTGGAGACCCAGAGAGG - Intergenic
988065560 5:26226299-26226321 CTGCAGCTGGAGACCCAGAGAGG - Intergenic
988065572 5:26226398-26226420 GTGCAACTGGAGACCCAGAGAGG - Intergenic
988065636 5:26226887-26226909 ATGCAGCTGGAGACCCAGAGAGG - Intergenic
988065644 5:26226981-26227003 TTGCAGCTGGAGACCCAGAGAGG - Intergenic
988065685 5:26227328-26227350 GTGCAGCTATAGACCCAGAGAGG - Intergenic
988065698 5:26227428-26227450 GTGCAGCTGGAGACCCAGAGGGG - Intergenic
992382844 5:76255750-76255772 GTGGCTCAGCAGAACCTGAGGGG - Intronic
998119252 5:139562088-139562110 GTGCAGCGGCAGTCCCAGACTGG - Intronic
998821293 5:146060059-146060081 GTGCATCAGCAGGGGCAGTGAGG + Exonic
999257012 5:150215349-150215371 GTGAAGCAGCAGATTCAGAGGGG - Intronic
1001659608 5:173381243-173381265 GTGCTTCATCAGACAGAGAGAGG + Intergenic
1001664511 5:173421392-173421414 CAGTACCAGCAGACCCAGAGAGG - Intergenic
1002789555 6:427331-427353 ATGCATCAGCACACCCTGGGTGG + Intergenic
1003448171 6:6204492-6204514 ATGTATTAGCAGAACCAGAGAGG - Intronic
1004294158 6:14394964-14394986 GTCCATCAGAAGTACCAGAGAGG + Intergenic
1004425086 6:15501694-15501716 GGGCAGCAGGAGACCCAGTGAGG + Intronic
1005859608 6:29890140-29890162 GTGCAACTGCAGACCCAGGGTGG - Intergenic
1006811318 6:36822246-36822268 GCGCCTCAGCAGACCCAGCCTGG + Intronic
1007014748 6:38453959-38453981 GTGCATCAGCAGGACAAAAGTGG + Intronic
1007643636 6:43363748-43363770 GTGCAGAAGCAGACCCACACTGG + Intronic
1007813729 6:44505186-44505208 GTGCACCAGAAGACCCAAACAGG - Intergenic
1008988517 6:57575483-57575505 GGGAATCAGCAGACCTAGATTGG + Intronic
1009177125 6:60474074-60474096 GGGAATCAGCAGACCTAGATTGG + Intergenic
1011321840 6:86104297-86104319 CTGCTTCAGCAGACTCAGATGGG + Intergenic
1012862676 6:104579562-104579584 GTGAAGCTGCAGAGCCAGAGGGG - Intergenic
1018382828 6:163275008-163275030 GTGCACCACCAGACCCAGCTAGG + Intronic
1018682639 6:166276679-166276701 GTGCATCACCACGCCCAGCGTGG + Intergenic
1019527539 7:1487471-1487493 GTGCGTCAGCACGCCCTGAGCGG + Intronic
1019847949 7:3525326-3525348 GTTTATCAGCAGACACAGATGGG + Intronic
1021006567 7:15401991-15402013 GTGAATAAGGAGACCCACAGTGG - Intronic
1021674210 7:23064165-23064187 GTGCACCTTCAGACACAGAGTGG - Intergenic
1022913405 7:34921788-34921810 GTGTGTAAGCATACCCAGAGAGG + Intergenic
1023122674 7:36925408-36925430 GTGCAGCAGCCAGCCCAGAGAGG - Intronic
1023860656 7:44216125-44216147 GTGCATCAGGGGGCCCAGCGGGG + Intergenic
1024415183 7:49097464-49097486 TTGCATCAGCATGCCCTGAGTGG - Intergenic
1025233147 7:57216404-57216426 GTGAAACAGAAGACCCAGAAAGG + Intergenic
1025233177 7:57216566-57216588 GTGGAGCTGCAGACCCAGGGAGG + Intergenic
1025233505 7:57218524-57218546 GTGAATCTGGAGACCCAGGGAGG + Intergenic
1025233653 7:57219352-57219374 GTGGATCTGGAGACCCAGGGTGG - Intergenic
1025245888 7:57316944-57316966 GTGCATCAGCAGGCCAAAAAAGG - Intergenic
1030951994 7:115802324-115802346 GAGCACCACCAGACGCAGAGGGG + Intergenic
1032655779 7:133928392-133928414 AGGCATCAGCAGAGACAGAGTGG - Intronic
1032674037 7:134111626-134111648 TTGCATAAGCAGACTCAGATGGG - Intergenic
1035565823 8:640295-640317 GTGTGTCAGCAGCTCCAGAGAGG - Intronic
1036719864 8:11164119-11164141 GTGAATAGGCAGACCCAGAAGGG - Intronic
1039141507 8:34394103-34394125 ATGCATCTGCAGTCCCAGGGAGG - Intergenic
1039675435 8:39660285-39660307 TTGAATCAGAAGACACAGAGTGG + Intronic
1042482758 8:69322708-69322730 GTGCAGCTGGAGACCCGGAGAGG + Intergenic
1042482762 8:69322755-69322777 GTGCAGCTGCAGACCCAGAGAGG + Intergenic
1042482775 8:69322855-69322877 CTGCAGCTGGAGACCCAGAGAGG + Intergenic
1043220273 8:77653941-77653963 TTGGATCAGGAGACACAGAGAGG + Intergenic
1047016727 8:120731470-120731492 TTTCATCAGCTGACCCAGAGAGG - Intronic
1047344030 8:124009938-124009960 GTGGAACTGCAGACCCAGGGAGG + Intronic
1049842941 8:144785868-144785890 GTCCATCAGCAAAGTCAGAGTGG + Intronic
1050093269 9:2037620-2037642 GTGCATCTGCAGAATCACAGAGG - Intronic
1051807460 9:21011297-21011319 GTGAATAAGCAGACTCTGAGAGG + Intronic
1058421058 9:104833870-104833892 CTCAATCAGCAGATCCAGAGGGG + Intronic
1058697893 9:107575106-107575128 CTGATTCAGCAGCCCCAGAGTGG + Intergenic
1058905190 9:109477112-109477134 GTGGATCAGTGGACTCAGAGTGG - Intronic
1060251012 9:121986726-121986748 GTGCAGCCTCAAACCCAGAGAGG - Intronic
1060883391 9:127134025-127134047 GTGATTCAGCACACACAGAGAGG + Intronic
1061988894 9:134146931-134146953 GTTCTCCAGCAGACACAGAGGGG - Intronic
1062090099 9:134671567-134671589 CTGAGTCAGCAGAGCCAGAGAGG + Intronic
1062486201 9:136777524-136777546 GTGGATCTGGAGACCCAGGGTGG + Intergenic
1186835931 X:13437742-13437764 GAGCATCAGCTGATCCTGAGGGG - Intergenic
1188375374 X:29421996-29422018 GTGCATGAGGAGAACCAGGGTGG + Intronic
1192275302 X:69623769-69623791 GTGGAGAAGCAGACCCAGAGGGG + Intronic
1197264059 X:124347313-124347335 CTACATCAGCAGATCCAGAGAGG - Intronic
1198252465 X:134893167-134893189 GTACTTCATCAGAGCCAGAGAGG + Intronic
1201473917 Y:14360807-14360829 GTGGATGAGCAGACACAGAATGG - Intergenic