ID: 1096076936

View in Genome Browser
Species Human (GRCh38)
Location 12:48811808-48811830
Sequence ATCAGGCCTCTGGACAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096076936_1096076945 4 Left 1096076936 12:48811808-48811830 CCCAGTCTGTCCAGAGGCCTGAT 0: 1
1: 0
2: 1
3: 11
4: 172
Right 1096076945 12:48811835-48811857 GAAGGAGGGTGCGATCTTGCTGG 0: 1
1: 0
2: 0
3: 13
4: 106
1096076936_1096076943 -10 Left 1096076936 12:48811808-48811830 CCCAGTCTGTCCAGAGGCCTGAT 0: 1
1: 0
2: 1
3: 11
4: 172
Right 1096076943 12:48811821-48811843 GAGGCCTGATTTGGGAAGGAGGG 0: 1
1: 0
2: 1
3: 55
4: 449
1096076936_1096076946 5 Left 1096076936 12:48811808-48811830 CCCAGTCTGTCCAGAGGCCTGAT 0: 1
1: 0
2: 1
3: 11
4: 172
Right 1096076946 12:48811836-48811858 AAGGAGGGTGCGATCTTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096076936 Original CRISPR ATCAGGCCTCTGGACAGACT GGG (reversed) Intergenic
900241989 1:1621548-1621570 GTGAGGCCTCTGGACAGATGAGG + Intronic
900635483 1:3662811-3662833 ACCAGGCCCCAGGACAGACCTGG + Intronic
901013444 1:6213786-6213808 GTCAGGACTCTGCACAGACTTGG - Intronic
903096585 1:20981210-20981232 TTGAGGCCTCTGGAAAAACTGGG + Exonic
903763207 1:25713697-25713719 CTCCGGCCTCTGTTCAGACTAGG + Intronic
904196028 1:28786093-28786115 ATCAAGCCACTGCACAGCCTGGG - Intergenic
904695315 1:32327361-32327383 GTCAGGCCTCTGGAGACACCCGG + Intronic
906215085 1:44033922-44033944 ATCAGGACTGAGGACAGACTGGG + Intergenic
906381606 1:45335763-45335785 ATCATGCCACTGCACAGCCTGGG + Intronic
906446820 1:45907501-45907523 ATCACGCCACTGCACAGCCTGGG - Intronic
912471960 1:109912256-109912278 ACAAGGCCTCTGGAGAGACCTGG - Intronic
912555632 1:110514074-110514096 ATCAGACCCCAGGACAGGCTGGG - Intergenic
914249781 1:145912264-145912286 TTCATTCCTCTGGACAAACTAGG - Exonic
915211225 1:154311109-154311131 AATAGGCATCTGGAGAGACTGGG - Intergenic
915212361 1:154320016-154320038 AATAGGCATCTGGAAAGACTGGG - Intergenic
915387383 1:155507827-155507849 ATCATGCCACTGCACAGCCTTGG + Intronic
915511482 1:156389133-156389155 CTCAGGGCTCTGGAAAGAATTGG - Intergenic
920207977 1:204306895-204306917 ATCAGTCCTCTGGATACACATGG + Intronic
921891723 1:220360475-220360497 ATAAAGCCTCTGGCCAGTCTAGG + Intergenic
922295015 1:224242527-224242549 ATCACGCCACTGCACAGCCTGGG - Intronic
923562528 1:235052110-235052132 AACAGGCCACTGGCCAGATTTGG + Intergenic
923918947 1:238542184-238542206 AGGATGCCTCTGGACAGCCTTGG - Intergenic
924865712 1:247977967-247977989 ATCAGCCTTCTGGAGAGACTTGG - Intronic
924869746 1:248028176-248028198 ATCAGCCTTCTGGAGAGACTTGG - Intronic
924871051 1:248044848-248044870 ATCAGCCTTCTGGAGACACTTGG - Intronic
1065820378 10:29519781-29519803 ATCATGATTCTGAACAGACTGGG + Intronic
1065975887 10:30842090-30842112 ATTAGGCTTTTGGCCAGACTTGG - Intronic
1070163253 10:73878919-73878941 ATCATGCCACTGAACAGTCTAGG - Intergenic
1070379576 10:75868696-75868718 ACCAAGCATCTGGACACACTGGG - Intronic
1073034313 10:100552629-100552651 AGGAGGCCGCTGGAGAGACTAGG - Exonic
1073184080 10:101605084-101605106 ATCAAGGCTCTGGGCAAACTTGG - Intronic
1074200040 10:111226369-111226391 AGAGGGCCTCTGGGCAGACTTGG - Intergenic
1076364673 10:129914317-129914339 ATCAGTGCTCTGGGCAGCCTTGG + Intronic
1077374739 11:2200174-2200196 ACCAGGGCTCTGGACAGGCCAGG + Intergenic
1078908712 11:15711350-15711372 CTCAGGCCTCCTGACACACTTGG - Intergenic
1079804641 11:24914293-24914315 GTCAGACCTCTGGACAACCTAGG - Intronic
1079858098 11:25631200-25631222 ATCTAGCCTCTGTACAGACTTGG + Intergenic
1081777113 11:45683178-45683200 TTCATGCCTGTGGACAGATTTGG - Intergenic
1082986735 11:59175499-59175521 ATCAGACCTCTAGGCAGTCTGGG - Intronic
1084270684 11:68027625-68027647 ATCAGCCCACTGGACAGATGGGG + Intronic
1084317182 11:68352327-68352349 GTCACGCCTCTGTACAGACAAGG - Intronic
1084823300 11:71709374-71709396 ATCAGGCCTTTGGACAACTTCGG - Intergenic
1086512319 11:87572374-87572396 ATCAGGCATATGTACAAACTGGG + Intergenic
1089142008 11:116292847-116292869 ATCTGGCCTTTGGACAGACCAGG - Intergenic
1089289095 11:117427052-117427074 ACCAGGCCTCTGGACACCCACGG + Intergenic
1092786668 12:12032886-12032908 ATCCGGCATGTGGACAGACACGG + Intergenic
1094598694 12:31889081-31889103 ATCACGCCATTGGACACACTGGG - Intergenic
1095260412 12:40092810-40092832 ATCAAGCCTCTTTACAGTCTGGG + Intronic
1096076936 12:48811808-48811830 ATCAGGCCTCTGGACAGACTGGG - Intergenic
1096773632 12:53951322-53951344 CTGCGGCCTCTGGACAGACCAGG + Intergenic
1098108400 12:67095211-67095233 ATCTGGGCTCTGGACAGTCTCGG + Intergenic
1102328003 12:112005454-112005476 AACAGGCCCCTGGAAAGACAAGG + Intronic
1104039885 12:125122801-125122823 AACAGGGCTCTGGGCAGTCTCGG + Intronic
1104719294 12:131036096-131036118 ATCAGGCCCCTGGAGAGGCATGG + Intronic
1113449999 13:110402439-110402461 ATCCGCCTTCTGGACACACTGGG + Intronic
1113595435 13:111528521-111528543 ACCTGGCCTCTGGACAGCCCAGG + Intergenic
1113595450 13:111528609-111528631 ACCTGGCCTCTGGACAGTCCAGG + Intergenic
1113726577 13:112607481-112607503 ATGAGGCCTCTGTGCACACTGGG - Intergenic
1114184980 14:20394120-20394142 ATCATGCCACTGCACAGACTAGG - Intronic
1114406542 14:22462267-22462289 ATCAATCCTCTGGACAATCTAGG - Intergenic
1116808004 14:49512014-49512036 ATCATGCCACTGTACAGCCTGGG + Intergenic
1120171718 14:81252948-81252970 ATCATGCCACTGCACAGCCTGGG - Intergenic
1121400040 14:93667806-93667828 ATAGGGCCTCTTGACAGAGTTGG + Intronic
1121860978 14:97317839-97317861 ATCAGGTCTCTGATCAGCCTTGG - Intergenic
1122543042 14:102508436-102508458 ATCATGCCTCTGAACAGCCCAGG - Intronic
1123715068 15:23022240-23022262 ATCAGGCTTATGGACAGGCAGGG + Intronic
1124558675 15:30750529-30750551 AGCAGGTCTCTGGCCAGACCAGG - Intronic
1124672576 15:31655101-31655123 AGCAGGTCTCTGGCCAGACCAGG + Exonic
1125449713 15:39795695-39795717 AACTGGCCCCTGGCCAGACTTGG - Intergenic
1128208692 15:65875707-65875729 AGCTAGCCTCTGGACAGTCTTGG - Intronic
1130832600 15:87616738-87616760 ATCAGCCCTCCAGACAGACTTGG - Intergenic
1133013738 16:2929482-2929504 ATCAGGCCCCCGGCCAGTCTTGG + Intronic
1139478396 16:67214844-67214866 TGCAGGCCTGTGTACAGACTTGG + Intronic
1140406992 16:74717725-74717747 AGCAGGGGACTGGACAGACTGGG + Intronic
1140623849 16:76769208-76769230 ATCAGGCCTCTGGAGAGAGCAGG - Intergenic
1141371134 16:83487217-83487239 AGCAGGCATGTGGACTGACTGGG - Intronic
1142434695 16:90048608-90048630 TTCAGGCGTCTGGTGAGACTGGG - Intergenic
1144220938 17:13099305-13099327 ACCAGGGCTCTGGAGGGACTCGG + Intergenic
1146631160 17:34470435-34470457 AGCAGGCATCTGGTCAGATTTGG + Intergenic
1152118848 17:78405792-78405814 AACAGGCCTCTGGACTGCCCAGG - Intronic
1153285984 18:3454242-3454264 ATCAGGCTTCTTGTCAAACTAGG + Intronic
1155155251 18:23152028-23152050 TTCAGGCCTATGGACTGATTGGG + Intronic
1155649726 18:28126945-28126967 ATCATCCCTCTGGACATTCTAGG - Intronic
1155991950 18:32287307-32287329 ATCAGGACTCTGGAGATAGTGGG - Exonic
1157341577 18:46783072-46783094 ATAAGGGCTCTTGACAAACTAGG - Intergenic
1157943555 18:51955040-51955062 ATCAGGACTCTGGCCAGGGTGGG + Intergenic
1159658900 18:71068685-71068707 ATCAGGGCTCAGGAGTGACTCGG + Intergenic
1159963778 18:74576751-74576773 AGCAGGCCTCTTGACTGTCTGGG - Intronic
1161861326 19:6800665-6800687 ATCACGCCACTGCACAGCCTGGG - Intronic
1163270483 19:16250329-16250351 ATAAGGCCCCTGGCCAAACTGGG + Intergenic
1166783878 19:45356355-45356377 GTCAGGCCTCTGGAGAGACTCGG - Intronic
1168660806 19:58164552-58164574 ATCAGCCACCTGGAGAGACTGGG + Intergenic
925668559 2:6288326-6288348 CTCAGGGCTCTGCACTGACTTGG - Intergenic
930697632 2:54428214-54428236 ATCAGGCCAGTGGTCAGCCTTGG + Intergenic
933889992 2:86759270-86759292 GTCAGGCCTGTGAAAAGACTTGG - Intronic
937243294 2:120476270-120476292 TTCAGGCCTCTGGCCATACCAGG - Intergenic
937276015 2:120684902-120684924 ATCTCGTCTCTGGCCAGACTTGG - Intergenic
937294617 2:120802309-120802331 AGCAGCCCTGTGGTCAGACTGGG + Intronic
937784553 2:125879962-125879984 ATCTGGCCTATGGAAAGACATGG - Intergenic
938194294 2:129313635-129313657 ATCAGGCCACTGGCAAGCCTTGG - Intergenic
938209059 2:129449705-129449727 ATCATGCCACTGCACAGCCTGGG + Intergenic
939751366 2:146051475-146051497 ATCAGTCCTCTGGCCAGGCGCGG + Intergenic
939873253 2:147548272-147548294 TTCGGGCCTCTGGATATACTAGG - Intergenic
940566478 2:155368431-155368453 AGAAGGCCTCTGGACAGTCAGGG + Intergenic
943504521 2:188737218-188737240 ATCATGCATTTGGACAAACTAGG + Intronic
945314336 2:208355269-208355291 ACCAGACCACTGGACAGGCTTGG + Exonic
947898127 2:233694277-233694299 AACAGGCCTTTGGGCAGATTGGG - Intronic
948256527 2:236572653-236572675 ATCAGGGCTCTGGTTACACTGGG + Intronic
1169072727 20:2743077-2743099 ATCTGGCCTCTGTGCAGACATGG + Intronic
1169893612 20:10479048-10479070 CTCAGGCCTCTGCCCAGATTCGG + Intronic
1170187605 20:13608721-13608743 ACCAGGCATCTGGCCAGATTTGG + Intronic
1173805550 20:45922668-45922690 CTCAGGCCTCTGGGGAGATTAGG - Intergenic
1175899454 20:62354303-62354325 CTCAGGCCTCTGATCAGCCTGGG + Intronic
1179030792 21:37718000-37718022 ATCAGTGCTCTGGAAAGTCTGGG + Intronic
1181458701 22:23073691-23073713 ATCAGCCCTCTGGACTGAGCCGG + Intronic
1181579954 22:23822591-23822613 CTGAGGCCTTTGGACAGGCTTGG - Intronic
1183323432 22:37178674-37178696 ATGTGGCCTCTGGACTGTCTAGG - Intergenic
949942220 3:9163720-9163742 ATAAGGCCTCTGCACAGTCAGGG + Intronic
951262530 3:20527562-20527584 ATGAGGCCACTGAACAGATTAGG - Intergenic
955051272 3:55413585-55413607 AACAGGCATCAGGACGGACTTGG + Intergenic
955421300 3:58740611-58740633 ATAAGGCCTCTGAATAGATTTGG - Intronic
958731565 3:97965535-97965557 TTCAGCCCTCAGGCCAGACTAGG - Intronic
961478817 3:127166356-127166378 TGCAGGGCTCTGGACAGTCTGGG - Intergenic
971164437 4:24168511-24168533 ATCAGGACTCTGTACAGAAATGG + Intergenic
973577348 4:52303360-52303382 ATCAGGCCTCTGGACACTAATGG - Intergenic
974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG + Intergenic
974896607 4:67947828-67947850 ATAAGGCACCTGGACAGAGTAGG + Intronic
976121223 4:81784347-81784369 ATCACGCCACTGCACAGCCTGGG + Intronic
981124921 4:141094621-141094643 AACAGGCCTCAGGCCAGATTTGG + Intronic
987135843 5:14898668-14898690 ATCATGCCACTGCACAGCCTGGG + Intergenic
987738494 5:21874800-21874822 GTCAGGCCTCTAGCCCGACTGGG - Intronic
988738590 5:34047193-34047215 ATCAGGCTCCTGGATACACTGGG + Intronic
989123536 5:38028641-38028663 ATGAGCTTTCTGGACAGACTTGG + Intergenic
989157332 5:38356626-38356648 AGCAGGGCTCTGGGCAGGCTGGG - Intronic
991938526 5:71827692-71827714 ATGAGGCCTTTGGGCAGGCTAGG + Intergenic
994164903 5:96598326-96598348 AGCTGGCCTTTGGGCAGACTTGG - Intronic
994951258 5:106466322-106466344 GTCTGGCCTCTGGAGAGAATGGG + Intergenic
1000718269 5:164674522-164674544 AACAGACCTCTGGGCAGATTAGG - Intergenic
1001844549 5:174910344-174910366 ATCCCGACCCTGGACAGACTTGG - Intergenic
1002409582 5:179062934-179062956 GTCAGGCCTGAGGACAGATTTGG - Intronic
1004460843 6:15834416-15834438 ATAAGACCTCTGGAAAGGCTAGG - Intergenic
1006187835 6:32190672-32190694 AGCTGGCCTCTGGCCAGACTGGG + Intergenic
1007951819 6:45879547-45879569 AGCAGGCTTCAGGACAGCCTGGG - Intergenic
1009219377 6:60965169-60965191 ATCAGGGCACTGTACAGAGTAGG + Intergenic
1011124175 6:83988361-83988383 GTCAGGGCTGAGGACAGACTGGG + Intergenic
1016039361 6:139416213-139416235 ATCTGGTCTCTGTAGAGACTGGG + Intergenic
1019364605 7:626918-626940 ATCACGCCACTGCACAGCCTGGG - Intronic
1020409610 7:7876365-7876387 AGTAGGCCTCTGTAAAGACTTGG + Intronic
1021653021 7:22850081-22850103 ATCATGCCACTGCACAGCCTGGG - Intergenic
1021664643 7:22963747-22963769 AACAGGCATCAGGCCAGACTGGG + Intronic
1021883776 7:25118638-25118660 AACAGGCATCTGGTCAGATTGGG + Intergenic
1022123686 7:27335195-27335217 GTCAGGCCTTTGGAAAGAGTGGG - Intergenic
1023945779 7:44802003-44802025 ATCATGCCACTGTACAGCCTGGG + Exonic
1024235034 7:47391481-47391503 AACAGGCCACTTTACAGACTGGG + Intronic
1026550481 7:71364254-71364276 GTCAGGCCTCAGTACAGATTTGG + Intronic
1026835181 7:73633930-73633952 ATCAGGCCTACGGAAGGACTTGG + Intergenic
1027329523 7:77077267-77077289 AACAGGCCCCTGGCCAGATTTGG - Intergenic
1029745608 7:102514304-102514326 ATCAGGCCTCTGAACACCCCAGG + Intronic
1029763547 7:102613283-102613305 ATCAGGCCTCTGAACACCCCAGG + Intronic
1029786239 7:102794094-102794116 AACAGGCCCCTGGCCAGATTTGG + Intronic
1031987909 7:128175356-128175378 ATCAGGCTTTTGGCCAGACGTGG + Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1034537952 7:151737751-151737773 ATCAGGCATCTGCAGTGACTGGG - Intronic
1034538170 7:151738879-151738901 ATCAGGCATCTGCAGTGACTGGG - Intronic
1036070180 8:5434012-5434034 CTCAGGCCTCAGGAGAAACTCGG - Intergenic
1037432572 8:18829192-18829214 ATCATGCCACTGTACAGCCTGGG + Intronic
1038649006 8:29385484-29385506 TCCAGGGCTCTGGACAGACCCGG + Intergenic
1038724320 8:30066817-30066839 ACCAGGGTTCTGGACAGGCTTGG - Exonic
1039074971 8:33682094-33682116 ATCACGCCACTGCACAGCCTCGG - Intergenic
1040068712 8:43171291-43171313 CTCAGGGCTCTGGTGAGACTGGG - Intronic
1042324513 8:67515040-67515062 CTCAGCCCTCTAGAGAGACTGGG + Intronic
1042409759 8:68450606-68450628 ATCAGCACTCTGGAGTGACTGGG + Intronic
1042531687 8:69822182-69822204 GACAGGCCTCAGGACATACTTGG - Intronic
1045076141 8:98570963-98570985 TACAGGCTTCTGGACTGACTTGG + Intronic
1049070729 8:140353636-140353658 ATCAGGCCGCGGGCCAGACCTGG + Intronic
1054704195 9:68446119-68446141 GTCAGGCCTCTGGATATATTTGG - Intronic
1187825989 X:23334142-23334164 TTTAAGCCTCTGGAGAGACTCGG + Exonic
1189299927 X:39945016-39945038 ATCATGCCACTGCACAGCCTGGG + Intergenic
1189543772 X:42020674-42020696 ATCATGCCACTGTACAGCCTGGG - Intergenic
1191105637 X:56770449-56770471 AACAGGCCTCTGGGCGGACGCGG + Intergenic
1191106630 X:56775851-56775873 AACAGGCCTCTGGGCGGACGCGG + Intergenic
1195666823 X:107439291-107439313 ATAAGGCCTCTGGAAACCCTAGG + Intergenic
1196465744 X:115969801-115969823 ATCAGGGCACTGGTCAGACAGGG - Intergenic
1198026718 X:132714356-132714378 ATCATGCCGCTGCACAGCCTGGG - Intronic
1199672444 X:150158643-150158665 GGCAGGCCAGTGGACAGACTTGG + Intergenic