ID: 1096077642

View in Genome Browser
Species Human (GRCh38)
Location 12:48815146-48815168
Sequence AGCCGCCGCCGGAGGATGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 138}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096077636_1096077642 -4 Left 1096077636 12:48815127-48815149 CCGCCGAGGTCGGGGTCGCAGCC 0: 1
1: 0
2: 1
3: 13
4: 108
Right 1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG 0: 1
1: 0
2: 2
3: 9
4: 138
1096077637_1096077642 -7 Left 1096077637 12:48815130-48815152 CCGAGGTCGGGGTCGCAGCCGCC 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG 0: 1
1: 0
2: 2
3: 9
4: 138
1096077627_1096077642 25 Left 1096077627 12:48815098-48815120 CCAGCACTCTTGCTTTTCGGTCC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG 0: 1
1: 0
2: 2
3: 9
4: 138
1096077633_1096077642 -1 Left 1096077633 12:48815124-48815146 CCCCCGCCGAGGTCGGGGTCGCA 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG 0: 1
1: 0
2: 2
3: 9
4: 138
1096077631_1096077642 4 Left 1096077631 12:48815119-48815141 CCTTTCCCCCGCCGAGGTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 71
Right 1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG 0: 1
1: 0
2: 2
3: 9
4: 138
1096077635_1096077642 -3 Left 1096077635 12:48815126-48815148 CCCGCCGAGGTCGGGGTCGCAGC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG 0: 1
1: 0
2: 2
3: 9
4: 138
1096077634_1096077642 -2 Left 1096077634 12:48815125-48815147 CCCCGCCGAGGTCGGGGTCGCAG 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG 0: 1
1: 0
2: 2
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096077642 Original CRISPR AGCCGCCGCCGGAGGATGGG CGG Intronic
900108477 1:996210-996232 AGCCGCCACCTGAGGTGGGGAGG + Intergenic
902180317 1:14683390-14683412 AGCCCCCGGAGGAGAATGGGTGG - Intronic
903128655 1:21264115-21264137 AACCGCAGCCTGAGGATGAGGGG + Intronic
906653819 1:47533587-47533609 GGGCGGCGCCGGAGGATCGGGGG + Intergenic
911875533 1:103157562-103157584 AGCAGCCTCCAGAGGCTGGGAGG + Intergenic
916033017 1:160894925-160894947 AGCGGCCGCGGGAGACTGGGGGG - Intergenic
920037592 1:203076027-203076049 ACCCGGGGCGGGAGGATGGGGGG - Intronic
920367762 1:205457050-205457072 CGCCGCCGCCGGAGGCCGCGCGG + Intergenic
1063664716 10:8054460-8054482 GGCGGCCGCCGGCGGAGGGGCGG - Intronic
1065140382 10:22714103-22714125 AGCTGCAGCCGGAGGAGGAGGGG + Intronic
1067001763 10:42621216-42621238 AGCCCCCTCAGGAGGATGAGTGG + Intronic
1069019161 10:63466044-63466066 AGCAGCCGCGGGAGGGTCGGCGG + Intergenic
1069703366 10:70441777-70441799 ACCCCCCTCCGGAGGGTGGGGGG + Intronic
1070800698 10:79243115-79243137 AGCCGCGGCGGGGGGAGGGGAGG - Intronic
1072637364 10:97186434-97186456 TGCTGCCGTCGGGGGATGGGGGG - Intronic
1076413172 10:130265927-130265949 AGACGGGGCCGGAGGAAGGGAGG + Intergenic
1076981861 11:208942-208964 AGCGGCCGCCTGAGGCCGGGGGG + Intronic
1077136226 11:1000494-1000516 TGCCGCCGGAGGAGGGTGGGGGG - Exonic
1077136229 11:1000497-1000519 CGCTGCCGCCGGAGGAGGGTGGG - Exonic
1077300862 11:1846336-1846358 AGCCGGAGCCGGAGGAGTGGGGG - Intergenic
1077404797 11:2378070-2378092 AGCCGCCGCCCCTGGATGGTGGG + Intronic
1080496954 11:32829918-32829940 GGCGGCCGACGGAGGACGGGAGG - Intergenic
1081998020 11:47377254-47377276 AGCCACCCCAGGAGGCTGGGAGG - Intronic
1083966198 11:66045390-66045412 TGCAGGCGCTGGAGGATGGGTGG + Exonic
1084658435 11:70533067-70533089 AGACGTTGCCGGAGGCTGGGGGG + Intronic
1084670718 11:70605070-70605092 AGCAGCCCTCCGAGGATGGGAGG + Intronic
1087094825 11:94308100-94308122 AGACACCGTCGGAGGATGGGAGG - Intergenic
1091789648 12:3264469-3264491 AGCCGCCTCCCGGAGATGGGTGG + Intronic
1095954168 12:47797034-47797056 GGCCGCCGCCGGAGGCTGGGGGG + Exonic
1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG + Intronic
1096154917 12:49336497-49336519 AGCCGCCGCAAGAGGGTGGCGGG - Exonic
1096818493 12:54216457-54216479 AGCTGCAGCAGGAGGAAGGGTGG - Intergenic
1098595967 12:72273146-72273168 AGCCGCCGTCGGAGGAGGAGCGG + Exonic
1100391883 12:94150707-94150729 AGCCGCCGGGAGAGGCTGGGCGG + Intronic
1103721222 12:122976599-122976621 AGTGGCCTCAGGAGGATGGGAGG + Intronic
1108448135 13:50529489-50529511 AGCCGCGCCCGCAGGAGGGGAGG - Intronic
1108639709 13:52371710-52371732 AGCAGCAGCAGCAGGATGGGGGG + Intergenic
1110219583 13:73059219-73059241 GGCTGCCGGCGGAGGAGGGGAGG - Exonic
1113310446 13:109127086-109127108 AGCCGGAGCCAGAGGACGGGTGG + Intronic
1113657007 13:112073337-112073359 AGCCGCCGGCGGGGGGCGGGTGG + Intergenic
1114065293 14:19054641-19054663 AGCCCGCGGCGGAGGATGGCAGG + Intergenic
1114096969 14:19345361-19345383 AGCCCGCGGCGGAGGATGGCAGG - Intergenic
1117504560 14:56389166-56389188 GGCCACTGCTGGAGGATGGGTGG + Intergenic
1122183413 14:99971743-99971765 GGCCGCCGCCGGGGGATGGGGGG - Intronic
1122272197 14:100573299-100573321 AGGGGCCGCCAGAGGAGGGGCGG + Intronic
1124126941 15:26944980-26945002 AGCCGCCACAGGAGGCAGGGCGG - Intronic
1125300882 15:38252618-38252640 AGACGCCGCCGGGGGTTGAGGGG + Exonic
1126436995 15:48646245-48646267 AGCAGACGCCGGAGGCCGGGAGG + Intergenic
1132594849 16:744024-744046 AGCCGCCCCCGGTGGTTGGGTGG + Intronic
1133221237 16:4319997-4320019 AGCCCCTGCTGGGGGATGGGTGG + Intronic
1136237813 16:28925280-28925302 GGCCCCGGACGGAGGATGGGGGG + Exonic
1141582722 16:85011321-85011343 CGCCGCCGCCGCAGGCCGGGAGG - Exonic
1141738417 16:85871916-85871938 AGCCGCCCCAGGAGCTTGGGAGG - Intergenic
1142280775 16:89146511-89146533 AGGTGCCGACGGAGAATGGGTGG - Intronic
1142764167 17:2056443-2056465 AGCGGCCGCCGGTGGAGGGGAGG - Intronic
1143174785 17:4949666-4949688 ACCCGCCGCCGAGGGCTGGGCGG + Intronic
1147879703 17:43645958-43645980 GGCCTCCGCCGGGGGATGGAAGG + Intronic
1147951699 17:44111233-44111255 AGCCGCCGCCGGCAGCTGGCAGG + Intronic
1147967251 17:44199845-44199867 TGCCGCGACCGGAGGATGGATGG + Intronic
1147971297 17:44220070-44220092 TGCCGCCGCCGGGGAAGGGGGGG + Intronic
1148060046 17:44830051-44830073 ACCCGCCGCCGGGTGAGGGGCGG - Intronic
1148930104 17:51120801-51120823 GGCCGGGGCCGGAGGAGGGGAGG + Exonic
1151575885 17:74952393-74952415 AGCAGCCCCCGGAGGCTGCGGGG + Intronic
1152580946 17:81165463-81165485 AGCAGCCGGCGGGGGATGTGGGG - Intronic
1152587601 17:81196022-81196044 AGCCTCCCTCGGAGGCTGGGAGG - Intronic
1152744882 17:82034029-82034051 GGCCCCCGCCGGAGGCCGGGAGG + Exonic
1152870722 17:82751789-82751811 GGCCGCCGCCGGAGGACAGCGGG - Intergenic
1152922928 17:83074708-83074730 GGCCGCAGCCGGGGGATGCGTGG + Intergenic
1152924127 17:83079801-83079823 AGCCGGCGCCAGAGCATGCGGGG + Exonic
1160025445 18:75211826-75211848 AGCCGCCGCCGGAGTTCGCGGGG - Intronic
1160966474 19:1749008-1749030 AGCCCCCGCCGGAGGGTGCGCGG - Intergenic
1161964405 19:7540328-7540350 GGCTGCTGCAGGAGGATGGGTGG + Intronic
1162312410 19:9914732-9914754 TGCCGCCGCCGGCTGATGCGTGG - Intronic
1162395559 19:10416605-10416627 AGCCCCCGCGGGAGGAAGGGTGG + Intronic
1163607150 19:18281597-18281619 AGCCGCCGCCAGTGGAGGGCCGG - Exonic
1165386060 19:35511301-35511323 TGCCGCTGCCCGAGGATGGGCGG - Intronic
1165579545 19:36850339-36850361 AGCCGCCCTCTGAGGCTGGGCGG + Intronic
1165871406 19:38975795-38975817 CCCCGCAGCCGGAGGAGGGGCGG - Exonic
1168048384 19:53810393-53810415 AGCAGCAGCTGGAGGGTGGGGGG - Exonic
929151224 2:38750908-38750930 AGCCGCCGCCGAGGGCGGGGGGG + Intronic
929962371 2:46506424-46506446 AGCTGCCTCCTGAGGATGGTAGG - Intronic
930700872 2:54456848-54456870 AGGCGCCGGCGGAGGCAGGGAGG - Intronic
933980889 2:87549847-87549869 AGCCTCAGCAGGAGAATGGGGGG + Intergenic
936312941 2:111400938-111400960 AGCCTCAGCAGGAGAATGGGGGG - Intergenic
936470975 2:112798259-112798281 AGCAGAAGCCGGAAGATGGGAGG + Intergenic
938386381 2:130870131-130870153 AGACGCTGCTGGAGGGTGGGAGG + Intronic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
942453542 2:176123016-176123038 CGCCGCTGCCGGGGGCTGGGAGG - Exonic
943844968 2:192634413-192634435 GGCCACTGCTGGAGGATGGGGGG - Intergenic
945234834 2:207624841-207624863 AGCAGCCGATGGAGGAGGGGAGG - Intronic
945379737 2:209126103-209126125 AGCAGAGGCTGGAGGATGGGTGG - Intergenic
946426731 2:219602473-219602495 AGTCGCCGCCGCAGGCTGAGAGG - Exonic
947992449 2:234497613-234497635 AGCCGCGGCGCGAGGGTGGGAGG - Intergenic
949028501 2:241777313-241777335 AGCCGCAGACCGAGGCTGGGAGG - Intronic
1171246106 20:23610961-23610983 AGCAGCAGCCCGATGATGGGAGG - Intergenic
1171406377 20:24914854-24914876 AGCTGAGGCCTGAGGATGGGAGG - Intergenic
1173741783 20:45406823-45406845 AGGCGTCGGCGGAGGACGGGGGG - Intronic
1174214007 20:48902211-48902233 GGCAGCTGCCAGAGGATGGGAGG - Intergenic
1174606821 20:51767707-51767729 AGCAGTCGCAGGAGGGTGGGAGG - Intronic
1175004801 20:55670627-55670649 ATCCGAGGCGGGAGGATGGGAGG - Intergenic
1175127158 20:56760906-56760928 AGCTGCCGAAGGAGGAAGGGAGG - Intergenic
1175404668 20:58718355-58718377 AGCAGGGGCCAGAGGATGGGTGG - Intronic
1179558389 21:42195089-42195111 AGGCGCTGCAGGAGCATGGGCGG + Intergenic
1180483784 22:15777261-15777283 AGCCCGCGGCGGAGGATGGCAGG + Intergenic
1180733782 22:18001093-18001115 ACCTCCCGCCGGAGGATGCGTGG - Intronic
1180733897 22:18001501-18001523 CGGCGCAGCCGGGGGATGGGCGG + Intronic
1184160360 22:42693920-42693942 AGCCGCAGCAGGAGGTCGGGGGG + Exonic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
949970250 3:9397681-9397703 CGCCGCTGCCGGGGGAGGGGCGG + Intronic
951613977 3:24521893-24521915 ACCCGGCGGCGGAGGAAGGGCGG + Intergenic
952287333 3:31981383-31981405 GGCCGCGGCGGGAGGAGGGGCGG - Intronic
953989871 3:47475813-47475835 CGCCGCCGCCGCAGCTTGGGAGG - Exonic
954669475 3:52281047-52281069 AGCCGGCTCCAGTGGATGGGTGG + Intronic
955400395 3:58587097-58587119 AGACGCCGCCGGGGGAAGGAGGG + Intronic
961349081 3:126287609-126287631 AGCCGCAGCCCCAGGAAGGGCGG - Intergenic
962520744 3:136195850-136195872 GGCCGCCGCCGGCGGGCGGGAGG + Intronic
968286125 3:197509967-197509989 AGCTGCCCCAGGAGGAGGGGGGG - Exonic
968879766 4:3292969-3292991 GGCCGAGGCCGGAGGAGGGGCGG - Intergenic
969239710 4:5890344-5890366 TGCCGCTGCCGGAGGCTGAGCGG - Intronic
969789207 4:9480468-9480490 ATCCGGGGCCGGGGGATGGGGGG - Intergenic
978361127 4:107931875-107931897 CTCCGCCGCCGGAGGAAGGGAGG - Exonic
984715007 4:182917303-182917325 AGCCGGCACCGGATGGTGGGCGG - Exonic
985064278 4:186105406-186105428 AGCCCCCGCCGGAGGGAGTGGGG - Intronic
987340493 5:16935634-16935656 AGACTCCGCGGGGGGATGGGGGG + Intronic
996931752 5:128897015-128897037 TGCCGCTGCTGGAGGATGGTGGG + Intronic
997349158 5:133217846-133217868 AGCCGCCGAGGGAGGATGGAGGG - Intronic
998957641 5:147453734-147453756 AGCCGCCGCGGGAGCCCGGGAGG - Intronic
999188492 5:149730328-149730350 AGCCGCGGCTGGAAGATGGCGGG + Exonic
1000154612 5:158538528-158538550 AGCCGCAGCAGTAGGAGGGGAGG - Intergenic
1003051839 6:2787528-2787550 AGGCGCCGAGGGAGGATGGAAGG + Intergenic
1013155729 6:107490040-107490062 GGCCGGCGCGGGAGGAGGGGAGG - Exonic
1017324586 6:153130976-153130998 CGCCCCCGCCGGGGCATGGGCGG + Intronic
1018971865 6:168535773-168535795 CGCCGCCGGGGGAAGATGGGAGG + Intronic
1018971885 6:168535875-168535897 CGCCGCCGGGGGAAGATGGGAGG + Intronic
1019702355 7:2480135-2480157 AGCCCCCGCTGGAGGAGGCGCGG + Intergenic
1019749398 7:2719235-2719257 AGAGGCGGCCGGAGGATGGCAGG - Intronic
1022363508 7:29685579-29685601 AGCGGCCGCCGGAGACTAGGCGG - Intergenic
1024689719 7:51786173-51786195 AGCAGCCGCCGCCAGATGGGAGG - Intergenic
1027188370 7:75984719-75984741 GGCCGCCTCCTGGGGATGGGTGG - Intronic
1031966465 7:128031321-128031343 GGCCGCCGCCGGAGGGAGTGCGG + Intronic
1035468706 7:159096326-159096348 GGCCGATGCCGGAGGAGGGGAGG - Intronic
1038017924 8:23530254-23530276 AGCTGCAGCCAGAGGATAGGAGG - Intronic
1045852084 8:106713964-106713986 AGCAGCAGCCAGAGAATGGGAGG + Exonic
1049415296 8:142492270-142492292 AGTGACCGCCGGAGGAAGGGTGG - Intronic
1057192598 9:93095979-93096001 AGCCGACGCCGGAGGGGGCGGGG + Intergenic
1057533484 9:95875728-95875750 CGCCGCCGCCGGAGGAGGACAGG - Exonic
1060931328 9:127491355-127491377 AGCAGCTGCCAGAGGCTGGGAGG - Intronic
1061144827 9:128791508-128791530 AGCAGCCGCAGGAGGCAGGGCGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1187698071 X:21940770-21940792 AGCAGCCGCGGGAGACTGGGGGG - Exonic