ID: 1096078502

View in Genome Browser
Species Human (GRCh38)
Location 12:48818925-48818947
Sequence GTAGGAGTCGTCATACATGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096078502_1096078515 23 Left 1096078502 12:48818925-48818947 CCCCCATGTATGACGACTCCTAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1096078515 12:48818971-48818993 GGCGGTGAGTGCCCACGATGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096078502_1096078511 2 Left 1096078502 12:48818925-48818947 CCCCCATGTATGACGACTCCTAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1096078511 12:48818950-48818972 GCCCGGGTTTGAGGACTCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 77
1096078502_1096078516 24 Left 1096078502 12:48818925-48818947 CCCCCATGTATGACGACTCCTAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1096078516 12:48818972-48818994 GCGGTGAGTGCCCACGATGAGGG 0: 1
1: 0
2: 0
3: 7
4: 86
1096078502_1096078519 29 Left 1096078502 12:48818925-48818947 CCCCCATGTATGACGACTCCTAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1096078519 12:48818977-48818999 GAGTGCCCACGATGAGGGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 123
1096078502_1096078518 28 Left 1096078502 12:48818925-48818947 CCCCCATGTATGACGACTCCTAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1096078518 12:48818976-48818998 TGAGTGCCCACGATGAGGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 91
1096078502_1096078520 30 Left 1096078502 12:48818925-48818947 CCCCCATGTATGACGACTCCTAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1096078520 12:48818978-48819000 AGTGCCCACGATGAGGGTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 182
1096078502_1096078508 -7 Left 1096078502 12:48818925-48818947 CCCCCATGTATGACGACTCCTAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1096078508 12:48818941-48818963 CTCCTACGTGCCCGGGTTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 58
1096078502_1096078514 5 Left 1096078502 12:48818925-48818947 CCCCCATGTATGACGACTCCTAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1096078514 12:48818953-48818975 CGGGTTTGAGGACTCGGAGGCGG 0: 1
1: 0
2: 0
3: 10
4: 109
1096078502_1096078510 -1 Left 1096078502 12:48818925-48818947 CCCCCATGTATGACGACTCCTAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1096078510 12:48818947-48818969 CGTGCCCGGGTTTGAGGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1096078502_1096078517 27 Left 1096078502 12:48818925-48818947 CCCCCATGTATGACGACTCCTAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1096078517 12:48818975-48818997 GTGAGTGCCCACGATGAGGGTGG 0: 1
1: 0
2: 2
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096078502 Original CRISPR GTAGGAGTCGTCATACATGG GGG (reversed) Exonic
909686136 1:78351094-78351116 TTAGCAGTCCTCATGCATGGTGG - Intronic
912934091 1:113987702-113987724 GTAAGGGACGTCTTACATGGAGG + Intergenic
918507389 1:185271458-185271480 GTAGGAGTTCTCAAACATAGTGG + Intronic
1069461899 10:68603488-68603510 ATATGAGTCATCATACCTGGTGG - Intronic
1077729322 11:4712352-4712374 CTAAGAGTAGTCATAGATGGCGG + Intronic
1078337424 11:10475163-10475185 GGAGCAGGCGTCTTACATGGTGG + Intronic
1094188872 12:27676492-27676514 GAAGGGGTTGTCATCCATGGAGG - Exonic
1096078502 12:48818925-48818947 GTAGGAGTCGTCATACATGGGGG - Exonic
1105261189 13:18780554-18780576 GTTGGAGTCCCCATACAGGGAGG - Intergenic
1108622837 13:52200877-52200899 GAACGAGTCGTCTTACGTGGAGG - Intergenic
1114570125 14:23660997-23661019 GTAGGAGTCAGCAAACACGGGGG - Intergenic
1114838754 14:26236514-26236536 GTAAGAGTATTTATACATGGTGG - Intergenic
1119961323 14:78859890-78859912 GTAGGAGTCTTCACTGATGGAGG - Intronic
1202834922 14_GL000009v2_random:70892-70914 GTTGGAGTCCCCATACAGGGAGG + Intergenic
1125202141 15:37109612-37109634 GTAACACTTGTCATACATGGCGG - Intergenic
1139692711 16:68651225-68651247 GGAGGAGTTGTCATACTTGTTGG + Intronic
1141581999 16:85005902-85005924 GGAAGTGTCGTCATACATGTAGG - Intronic
1144778022 17:17794642-17794664 GAAGGAGTCGTCAGATTTGGTGG - Exonic
1148545383 17:48514733-48514755 GTGGGAGTCATGATACAGGGAGG - Intergenic
1149294696 17:55251385-55251407 TTAGGAGTCTTCAAAGATGGTGG + Intergenic
1154424837 18:14264253-14264275 GTTGGAGTCCCCATACAGGGAGG + Intergenic
1154427518 18:14283586-14283608 GTTGGAGTCCCCATACAGGGAGG + Intergenic
1154432522 18:14319476-14319498 GTTGGAGTCCCCATACAGGGAGG + Intergenic
1155184812 18:23378169-23378191 GAAAGAGTAGCCATACATGGTGG - Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1162042159 19:7977590-7977612 GTGGGAGTGGTCCTGCATGGAGG - Intronic
1168451680 19:56471183-56471205 GGAGGAGGTGTCTTACATGGTGG - Intronic
1202637781 1_KI270706v1_random:56800-56822 GTTGGAGTCCCCATACAGGGAGG - Intergenic
926792419 2:16587793-16587815 GTAAGGGACGTCTTACATGGTGG - Intronic
928489018 2:31761928-31761950 GGAGCAGTCGTCTTACATGGTGG - Intergenic
940279369 2:151973696-151973718 GTACAAATTGTCATACATGGAGG + Intronic
941000293 2:160195512-160195534 GTTGAGGTCGTCATCCATGGAGG + Exonic
1170393605 20:15902655-15902677 GCTGGGGTCCTCATACATGGCGG - Intronic
1171884355 20:30640892-30640914 GTTGGAGTCCCCATACAGGGAGG - Intergenic
1173298660 20:41781455-41781477 TTAGGAATCATGATACATGGAGG - Intergenic
1175142827 20:56873459-56873481 GTTGGAGCCATCATACATTGGGG + Intergenic
1176844518 21:13866272-13866294 GTTGGAGTCCCCATACAGGGAGG - Intergenic
1176847244 21:13885835-13885857 GTTGGAGTCCCCATACAGGGGGG - Intergenic
1178476099 21:32938622-32938644 CTAGGAGTTGGGATACATGGGGG + Intergenic
954364714 3:50139698-50139720 CTAGGAGTGCTCATTCATGGGGG + Intergenic
1202765102 4_GL000008v2_random:142657-142679 GTTGGAGTCCCCATACAGGGAGG - Intergenic
987170020 5:15245375-15245397 GAAGGAGTCTACATCCATGGTGG + Intergenic
990631409 5:57674456-57674478 GCAAGACTCGTCTTACATGGTGG + Intergenic
1001642258 5:173252773-173252795 GCAAGGGACGTCATACATGGTGG + Intergenic
1019948975 7:4355550-4355572 GTAGCAGGTGTCTTACATGGTGG - Intergenic
1038618025 8:29113750-29113772 GTAGGACCTGTCATACATGGTGG - Intronic
1043033689 8:75170168-75170190 GTGGGAGCTGTCTTACATGGTGG + Intergenic
1043150836 8:76713988-76714010 GTAGGAGTTGACATGAATGGGGG - Intronic
1056112544 9:83410003-83410025 TTAGGAGTCGTCTGACCTGGAGG - Intronic
1203545850 Un_KI270743v1:127546-127568 GTTGGAGTCCCCATACAGGGAGG - Intergenic
1194064056 X:89240531-89240553 GTATGAGGCATCCTACATGGTGG - Intergenic
1198878729 X:141255759-141255781 GCAAGACTCGTCTTACATGGTGG - Intergenic
1200718231 Y:6574630-6574652 GTATGAGGCATCCTACATGGTGG - Intergenic