ID: 1096083585

View in Genome Browser
Species Human (GRCh38)
Location 12:48849857-48849879
Sequence TCCTCCCCAGGCAGGAGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 273}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096083585_1096083589 -2 Left 1096083585 12:48849857-48849879 CCTTCGCTCCTGCCTGGGGAGGA 0: 1
1: 0
2: 2
3: 34
4: 273
Right 1096083589 12:48849878-48849900 GATCACCTGAGCCCAGGCTGAGG 0: 1
1: 7
2: 173
3: 1271
4: 5880
1096083585_1096083588 -8 Left 1096083585 12:48849857-48849879 CCTTCGCTCCTGCCTGGGGAGGA 0: 1
1: 0
2: 2
3: 34
4: 273
Right 1096083588 12:48849872-48849894 GGGGAGGATCACCTGAGCCCAGG 0: 32
1: 2098
2: 15457
3: 48759
4: 139698
1096083585_1096083595 21 Left 1096083585 12:48849857-48849879 CCTTCGCTCCTGCCTGGGGAGGA 0: 1
1: 0
2: 2
3: 34
4: 273
Right 1096083595 12:48849901-48849923 TGGAAAGACTTCTTGACCCTGGG 0: 1
1: 0
2: 9
3: 234
4: 2234
1096083585_1096083594 20 Left 1096083585 12:48849857-48849879 CCTTCGCTCCTGCCTGGGGAGGA 0: 1
1: 0
2: 2
3: 34
4: 273
Right 1096083594 12:48849900-48849922 GTGGAAAGACTTCTTGACCCTGG 0: 1
1: 0
2: 5
3: 161
4: 1638
1096083585_1096083590 1 Left 1096083585 12:48849857-48849879 CCTTCGCTCCTGCCTGGGGAGGA 0: 1
1: 0
2: 2
3: 34
4: 273
Right 1096083590 12:48849881-48849903 CACCTGAGCCCAGGCTGAGGTGG 0: 1
1: 0
2: 13
3: 343
4: 4172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096083585 Original CRISPR TCCTCCCCAGGCAGGAGCGA AGG (reversed) Intronic