ID: 1096084817

View in Genome Browser
Species Human (GRCh38)
Location 12:48858312-48858334
Sequence TCCCCAGGGCCACTCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096084811_1096084817 13 Left 1096084811 12:48858276-48858298 CCAAAATGGCTCTGGGACGCTGC 0: 1
1: 0
2: 1
3: 7
4: 91
Right 1096084817 12:48858312-48858334 TCCCCAGGGCCACTCCAGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 249
1096084813_1096084817 -9 Left 1096084813 12:48858298-48858320 CCTCTGTGCGTCACTCCCCAGGG 0: 1
1: 0
2: 3
3: 148
4: 645
Right 1096084817 12:48858312-48858334 TCCCCAGGGCCACTCCAGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096084817 Original CRISPR TCCCCAGGGCCACTCCAGAG GGG Intronic
900569393 1:3350896-3350918 TCCCCAAGTCCCCTTCAGAGTGG - Intronic
900827271 1:4936870-4936892 TCCCCACAGCCTTTCCAGAGAGG - Intergenic
900853500 1:5162460-5162482 TCCCCAGGCACACAGCAGAGTGG + Intergenic
901664639 1:10819444-10819466 TCCCCAGAGCACCTCCAGGGAGG - Intergenic
901800895 1:11707423-11707445 TGCCCAGGGCCACACCCTAGTGG - Intronic
902589102 1:17460705-17460727 TTCCCAGGGCTCCTCCAGGGTGG + Intergenic
902955633 1:19922744-19922766 TGACCAGAGCCACTGCAGAGAGG + Exonic
903442035 1:23395387-23395409 AGCACAGGGCCACTCCAAAGAGG + Intronic
904288530 1:29469284-29469306 TCCCCAGGGTCACGGCAGTGGGG + Intergenic
905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG + Intergenic
906001610 1:42431196-42431218 TCTCCAGGACCACCCCAGAGTGG - Intronic
906798224 1:48714302-48714324 TCCACAGTGCCACCCCAGGGAGG + Intronic
907273495 1:53304395-53304417 TCCCCAGGCCCACTGCAGAAAGG + Intronic
907593194 1:55695453-55695475 TTCCAAGGGCCACTCCCCAGAGG + Intergenic
908041871 1:60122747-60122769 GCCCAAAGGCCACTCAAGAGTGG + Intergenic
909907700 1:81220507-81220529 TCGCAGTGGCCACTCCAGAGGGG - Intergenic
909968288 1:81946445-81946467 TTCCTAAGGCCATTCCAGAGAGG - Intronic
911176992 1:94826963-94826985 TCCCCAGGGGCAGGGCAGAGGGG - Intronic
912221794 1:107686202-107686224 TCCGAAGGTCCACTCCAGAATGG + Intronic
913986433 1:143569995-143570017 TCCCCAGGCCTGGTCCAGAGAGG - Intergenic
914909249 1:151770979-151771001 TTCCCAGGGCCACTCCCTAGTGG + Intronic
914985362 1:152451495-152451517 TGCTCAGGTCCACTCCGGAGAGG + Intergenic
915540052 1:156559971-156559993 GCCCCCGGGCCACTCCTGACTGG - Intronic
918015738 1:180631309-180631331 TCCCCAGGGACACTTCAGCCTGG + Intergenic
919819781 1:201465746-201465768 TACCCAGGCCCACTCCAGAATGG - Exonic
920212793 1:204340618-204340640 CCCCCAGGGCCATGTCAGAGAGG + Intronic
921720866 1:218469615-218469637 TCTTTAGGGCCACCCCAGAGTGG - Intergenic
923211663 1:231808954-231808976 GTCCCTGGGCCACTCCAGATAGG + Intronic
924504263 1:244666710-244666732 CCCTCAGGGTCACTACAGAGTGG - Intronic
1065590756 10:27259080-27259102 TCCCCAGGCCCACCCCATGGGGG + Intergenic
1065681763 10:28242592-28242614 TCTCCAGGACCCTTCCAGAGGGG + Intronic
1067804946 10:49385917-49385939 TCCCAAGGGCCAATCCACAGAGG + Intronic
1069719999 10:70543900-70543922 ACCCTAGGGCCACATCAGAGAGG + Intronic
1070779389 10:79128713-79128735 TCCCCAGGGCACCTCCAGAGTGG + Intronic
1070789430 10:79180627-79180649 TGCTTGGGGCCACTCCAGAGGGG - Intronic
1072662587 10:97371782-97371804 TCCCCAGGCCCATCCCAGACCGG - Intronic
1073289804 10:102407989-102408011 TCCCCAGGCCAACTGCACAGAGG - Intronic
1073465052 10:103689983-103690005 TTCCCAGGGTCACTCCAGCCAGG - Intronic
1073545840 10:104348081-104348103 TCCCCAGGGCCACAGCTGATGGG - Intergenic
1075870349 10:125768332-125768354 TCTCAAATGCCACTCCAGAGAGG + Intronic
1076348956 10:129801695-129801717 GCCCCTGGGCCACTCCAGGTGGG + Intergenic
1076353195 10:129832635-129832657 CCCCCCAGGCCACTCCAGGGTGG - Intergenic
1076820975 10:132939441-132939463 ACTCTAGGGCCACTCCACAGTGG + Intronic
1076857103 10:133122750-133122772 GCCCCAGGGCCAGGCCAGGGAGG - Intronic
1077412523 11:2410328-2410350 TCCTGAGCGCCACTCCACAGAGG + Intronic
1077414085 11:2416428-2416450 TCACCAGGGTCACTCAAGGGGGG + Intronic
1078335807 11:10462416-10462438 TCCCCAGGGCGACTCCACCTTGG - Intronic
1080966529 11:37219836-37219858 TCCCCATGGCCACTGCAGCTGGG + Intergenic
1081648051 11:44803625-44803647 TCCCCTGCTCCACTCCAGGGCGG - Intronic
1081704267 11:45171640-45171662 TCCCCAGTCCCATTCCAGATGGG - Intronic
1085389424 11:76175001-76175023 TCCCCAGAGCCCCTCCTTAGTGG - Intergenic
1085456971 11:76670809-76670831 ACCCCACGGCCTCGCCAGAGGGG - Intergenic
1085661428 11:78370884-78370906 TCCCCAGTGACTGTCCAGAGTGG - Intronic
1086523310 11:87697051-87697073 TCCACAGGGCCAGCCCAGAAAGG - Intergenic
1088342901 11:108789002-108789024 TCAACAGGGCCAGCCCAGAGAGG - Intronic
1088652676 11:111972327-111972349 TCCCCAAGCCCACTCCACATGGG - Intronic
1089302522 11:117507319-117507341 TACCCTGGGCCCATCCAGAGTGG + Intronic
1090905471 11:131070793-131070815 TCCACAAGTCCTCTCCAGAGAGG - Intergenic
1092831566 12:12449172-12449194 TCCCCACTGCCACTCTGGAGGGG + Intronic
1094836958 12:34326571-34326593 CCCACAGGGGCACCCCAGAGCGG - Intergenic
1095991534 12:48037835-48037857 TCCCCAGGTCATCCCCAGAGAGG + Intergenic
1096084817 12:48858312-48858334 TCCCCAGGGCCACTCCAGAGGGG + Intronic
1098003369 12:65969077-65969099 TCCCCAGAGCCAGTCCATAAAGG + Intergenic
1098054768 12:66493148-66493170 TGCCCAGGCCCATCCCAGAGGGG - Intronic
1101043342 12:100779217-100779239 ACCCCAGTGGCACTTCAGAGAGG - Intronic
1101365426 12:104065310-104065332 TTCCGAGGGCCAGTCCAGAAGGG - Intronic
1102945116 12:116979948-116979970 TCCCCAGGCCCTCTCCAGGTGGG + Intronic
1103257721 12:119556618-119556640 GCCCCAGGTCCCCTCCACAGAGG - Intergenic
1104356368 12:128090223-128090245 TCCCCAGGGCCTCGAGAGAGTGG + Intergenic
1104729739 12:131098243-131098265 TCCCCAAGTCCAATCCCGAGCGG + Intronic
1105405371 13:20128356-20128378 CCCCCAGCGCCACCCCAGGGCGG - Intergenic
1106775081 13:33001335-33001357 TCCCCAGGGACATTCCTGGGAGG - Intergenic
1107542456 13:41403817-41403839 TCCCCAGGGCCCCACCAGGCTGG - Intergenic
1114999010 14:28398548-28398570 TCTTCAGGGCCACTGCTGAGTGG + Intergenic
1116221818 14:42096729-42096751 TCCCAGGGGCCGCTTCAGAGGGG + Intergenic
1119806809 14:77487584-77487606 TCCCAAGAGCAGCTCCAGAGAGG - Intronic
1121556946 14:94845332-94845354 TCCCCAGGGCCATTCAAAATGGG - Intergenic
1124707101 15:31975203-31975225 TCCGCAGGGCTACACCAGAGTGG - Intergenic
1125490896 15:40147680-40147702 GCCCCAGGGCAGCTCCAGAAGGG + Intergenic
1127169801 15:56289724-56289746 GCTCCATGGCCACTCCATAGGGG - Intronic
1127286549 15:57538508-57538530 TCTCCAGGGGCCCTCCAGGGAGG + Intronic
1127536673 15:59896199-59896221 TTCTCAGGGCAATTCCAGAGAGG + Intergenic
1128646332 15:69381228-69381250 TCCCCCTGGCCACTCCAGGGAGG - Intronic
1128910482 15:71509307-71509329 TCCACAGGGGCAATGCAGAGAGG - Intronic
1130071989 15:80655248-80655270 TTTTCAGGGCCACTCCTGAGTGG + Intergenic
1130139771 15:81215676-81215698 TCCACAGGGTCAATCCAGAAAGG - Intronic
1130672996 15:85929543-85929565 TTCCCAGGCACAATCCAGAGTGG + Intergenic
1130934297 15:88455587-88455609 TTCTCAGGCCCACTTCAGAGTGG + Intergenic
1130984618 15:88836879-88836901 TCCCCAGGCCCAGACAAGAGAGG + Intronic
1132587469 16:711815-711837 TCCCCAGGCCTCCTCCAGAGAGG - Intronic
1132769140 16:1551349-1551371 TCCCCAGGGCCAGTCAAGCCGGG + Intronic
1133042552 16:3068173-3068195 TCCCCAGGACGACTTCAAAGAGG + Exonic
1135590655 16:23702623-23702645 CCACCAGGGCCACTCCTGTGTGG + Exonic
1135600143 16:23775941-23775963 TCCCCAGTTCCAGTCTAGAGAGG + Intergenic
1137979206 16:53055366-53055388 CGCCCAGAGCCACTCCAGGGTGG + Intronic
1138194614 16:55043232-55043254 ACCCCAGGGCATCACCAGAGGGG + Intergenic
1139440611 16:66964774-66964796 ACCCCAGGGCCAGCACAGAGTGG - Intronic
1139700100 16:68703044-68703066 TCCCTATGGCCCCTCCAGTGGGG + Intronic
1140205178 16:72927672-72927694 TCCCCCGGGCGGCTCCGGAGGGG - Intronic
1140248036 16:73268900-73268922 GCCCCGGGGACACTCCACAGAGG + Intergenic
1141432476 16:83977570-83977592 TCCACAGAGCCCCTCCACAGAGG + Intronic
1141505940 16:84478751-84478773 TGCCCAGGGCTGCTCCCGAGGGG - Exonic
1141614484 16:85202683-85202705 CCCCCAGGGCCCCTCCCAAGGGG - Intergenic
1141841322 16:86576020-86576042 GCCCCAGCCCCGCTCCAGAGCGG - Intergenic
1141850970 16:86645713-86645735 TCTCCTGTGCCAGTCCAGAGGGG - Intergenic
1142049754 16:87950830-87950852 TCCCCAGTGTCTATCCAGAGGGG - Intronic
1142247179 16:88975533-88975555 TAGACAGGGCCGCTCCAGAGAGG + Intronic
1142438512 16:90078171-90078193 TCCAGAGGGCCAGTCCAGAAAGG - Intronic
1142549793 17:731977-731999 TCCTGAGGGCCACCCCGGAGCGG + Intergenic
1142811578 17:2397935-2397957 GCCCCTGGGTCACTGCAGAGGGG - Intronic
1143457787 17:7078870-7078892 TCCCCAGCTCCACCCCAGACTGG - Exonic
1143658720 17:8312136-8312158 TCCCCAGGGCCTCCCCACAATGG + Exonic
1145037412 17:19551101-19551123 GCCCCAGGCACACTCCAGATGGG - Intronic
1145258894 17:21343132-21343154 GCCCCAGGGCCCCAGCAGAGTGG - Intergenic
1145317730 17:21744872-21744894 GCCCCAGGGCCCCAGCAGAGTGG + Intergenic
1146946548 17:36877503-36877525 CCCCCAGGGCCCCTCCCCAGTGG - Intergenic
1147475963 17:40711885-40711907 GCCCCAGGGCCACTGCAGGTAGG - Intergenic
1147669713 17:42169935-42169957 TCCCCAGGGCCAGCACATAGTGG + Intronic
1148246303 17:46033038-46033060 TCCCCAGGGCCTGTGGAGAGAGG - Intronic
1149442257 17:56684604-56684626 TACCCAGGGTCATTCCAGAAGGG + Intergenic
1151132277 17:71909406-71909428 TCCTTAGGGCCTCTCCAGAAGGG - Intergenic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1152616175 17:81338904-81338926 TCCCCAGGCCCACTCTGTAGTGG + Intergenic
1153660873 18:7325143-7325165 TCGCCAGGGGCATTCCAAAGAGG + Intergenic
1155318140 18:24592566-24592588 TCCTCAGGGCAATGCCAGAGAGG + Intergenic
1160930311 19:1567143-1567165 CCCGCAGGGGCACCCCAGAGAGG - Intronic
1161007996 19:1945905-1945927 ACCCCATGGCCTCTCCAGGGAGG - Intronic
1161044294 19:2126873-2126895 TACCCAAGGGGACTCCAGAGTGG + Intronic
1161226415 19:3148584-3148606 TCCCCAGGCCCAGGCGAGAGCGG + Exonic
1161568458 19:5016669-5016691 TCCCCAGGGCCGATGCAGACAGG - Intronic
1162380672 19:10329843-10329865 ACGCCAGGCACACTCCAGAGGGG + Intronic
1163502016 19:17681812-17681834 CCCCCAGGGCCACTCCAGGAGGG - Intronic
1163831753 19:19550433-19550455 TCCCCAGGGCCCCGAGAGAGTGG - Intergenic
1164573665 19:29392538-29392560 TCCCCAGGCCCACTCCATGGAGG - Intergenic
1165077185 19:33286368-33286390 TCCCCAGGGCCAGTCCCTCGTGG - Intergenic
1165426211 19:35746788-35746810 TCCCCAAGGGCACCCCAGCGGGG - Exonic
1165938303 19:39402907-39402929 TCCCCACCGTCATTCCAGAGGGG + Intergenic
1166757546 19:45202720-45202742 TCCCCAGGGCCACCACAGCTGGG + Intronic
925351298 2:3202617-3202639 ACCACAGGGCCATTCCAGAAGGG + Intronic
925970733 2:9104989-9105011 TCCCCAGGGTCTCTACAAAGAGG + Intergenic
926134232 2:10325470-10325492 TCCCCAGTGCCAGGCCAGGGTGG + Intronic
927143610 2:20145983-20146005 TCCCTTGGGCCTCTCCAGAGAGG + Intergenic
928122274 2:28591784-28591806 GACCCAGGGCCCCTCCACAGGGG + Intronic
928580235 2:32700081-32700103 TGCCCATGCCCACTCCGGAGAGG + Intronic
930318776 2:49828558-49828580 CCCTCAGGGCCACTCCTGAGTGG + Intergenic
933778570 2:85786551-85786573 TCCCCAGGGCCACCCCTCTGAGG - Intronic
937290872 2:120781034-120781056 TGCCCAGGGCCCATGCAGAGTGG - Intronic
938123058 2:128647088-128647110 TGCCCAGCACCACCCCAGAGGGG + Intergenic
938728215 2:134125459-134125481 TACCCAGGGGCACTGCAGGGAGG + Intronic
938893001 2:135724077-135724099 TCCCCACTGCCACAGCAGAGGGG - Exonic
944857829 2:203785351-203785373 TCTCCAAGGCCCCACCAGAGTGG + Intergenic
945172637 2:207012732-207012754 TCCCCAGGAGCAATCTAGAGAGG + Intergenic
945660316 2:212677797-212677819 TCCACAGGGCTAGTCCAGAAGGG + Intergenic
946255151 2:218436670-218436692 TCCCCAGGGCCAAGAAAGAGTGG + Intronic
948047104 2:234952625-234952647 TCCCCAGCGCCGCTCGAGGGGGG - Intronic
948138972 2:235659095-235659117 TCCCCAGGGCAAGCCCAGAACGG - Intronic
948749647 2:240124313-240124335 TCCCCCAGGCCCCTCCAGAGTGG + Intergenic
948790204 2:240372860-240372882 CCCCCAGGGCCACTCCTGTTGGG + Intergenic
1169265268 20:4163459-4163481 TCCCCAGAGACTCCCCAGAGTGG - Intronic
1169513875 20:6295668-6295690 TCCCCACATCCACTCCACAGAGG - Intergenic
1171406543 20:24915655-24915677 TGCCAAGGGCAACTCCAGAGAGG + Intergenic
1171859538 20:30383969-30383991 TCCACAAGGCCTCTGCAGAGTGG - Intronic
1172063845 20:32206256-32206278 CCCCCCCGCCCACTCCAGAGTGG + Intronic
1173959824 20:47062355-47062377 TCCAAGGGGGCACTCCAGAGGGG - Intronic
1175260369 20:57670274-57670296 TTCACTGGGCCACTCCAGGGAGG + Intronic
1176053688 20:63133968-63133990 GCCCCAGGGCCACTCTGCAGGGG - Intergenic
1176307324 21:5130578-5130600 TTCCCAAGGGCACTGCAGAGGGG + Intergenic
1177101980 21:16909220-16909242 TCCCCAAGGCAACACCAGAATGG + Intergenic
1179661573 21:42879291-42879313 TCCCCGGGGTCACCCCAGAGTGG + Intronic
1179818777 21:43924482-43924504 TCCCCAGGTCCGCTCCCGTGAGG + Intronic
1179849735 21:44131452-44131474 TTCCCAAGGGCACTGCAGAGGGG - Intergenic
1179913322 21:44461340-44461362 TCCCCAGGGCCCTTCATGAGAGG - Exonic
1180411063 22:12609163-12609185 TCCACAAGGCCTCTGCAGAGTGG - Intergenic
1180928663 22:19574021-19574043 GCCCCAGGGCCACTACACAGGGG - Intergenic
1181031951 22:20152578-20152600 TCCCCAGAGCCAAGCAAGAGAGG - Intergenic
1181458565 22:23072958-23072980 TGCCCAGGGCCCCCGCAGAGAGG + Intronic
1181560313 22:23696165-23696187 TCCCCAGGGCCCCCAAAGAGAGG - Intronic
1181861008 22:25818160-25818182 GCCCCCAGCCCACTCCAGAGGGG - Intronic
1183032254 22:35115025-35115047 CTCCCAGGGTCACACCAGAGAGG - Intergenic
1183524144 22:38313944-38313966 GCCCCAGGGCCATCCCAGATGGG - Intronic
1184194558 22:42918160-42918182 ACACCAGGGCCACTGCAGACAGG + Intronic
1184390880 22:44202398-44202420 AGCCCAGGGGCACCCCAGAGTGG - Intronic
1184479303 22:44737626-44737648 TCCCCATGGCCACCCCAGGCAGG - Exonic
1184841207 22:47053323-47053345 TTGCCAGGGCCCCTCCTGAGAGG + Intronic
1184955537 22:47883709-47883731 TCCCCAGGGCCCCTCCTTGGTGG - Intergenic
1185180511 22:49358178-49358200 TCCCCCGGGCCACCTGAGAGAGG + Intergenic
1185275911 22:49950171-49950193 TCCCCTGAGCCCCTCTAGAGTGG - Intergenic
951168142 3:19506986-19507008 CTCCCATGGCCACTGCAGAGTGG - Intronic
952803953 3:37328187-37328209 TCCCCAGGACCACTACTTAGAGG + Intronic
952889435 3:38030477-38030499 TCCCAAGGGACTCTCCAAAGGGG - Intergenic
953383795 3:42493308-42493330 TCCCAAGGCCCTCTCGAGAGTGG - Intronic
953608116 3:44424924-44424946 TCCCCAGGGCCTCTCCACCTCGG + Intergenic
955780454 3:62478829-62478851 TCCCCAGCTCCCCTCCAGAGTGG + Intronic
956087516 3:65628261-65628283 TCCCCAAGACCACTCCTGATTGG + Intronic
957934073 3:86920162-86920184 TCCTCAGGTCAAATCCAGAGTGG - Intergenic
963235607 3:142952997-142953019 GCTCCAGGGCCACTCCTAAGAGG - Intronic
966758836 3:183396943-183396965 TCCCCAGGGCCTCTAGAGAGTGG + Intronic
966946539 3:184780964-184780986 ACCCCAGCTCCACTCCGGAGTGG - Intergenic
966949438 3:184803185-184803207 TCTCCAGTGCAACTCCAGAGAGG + Intergenic
968959051 4:3733617-3733639 TCCTGAGCGCCTCTCCAGAGCGG + Intergenic
969437001 4:7194043-7194065 GCCCCAGGGTGACTTCAGAGTGG - Intronic
981758335 4:148166358-148166380 TGGGCAGGGCCACGCCAGAGTGG + Intronic
984090479 4:175368394-175368416 TCCCCAGGACCAGTCCAGACTGG + Intergenic
985008727 4:185560569-185560591 TCCCCTTGGCCACCCCAGGGAGG - Intergenic
985341297 4:188957313-188957335 TCCCCAGTCCCACTCCACATGGG - Intergenic
985437685 4:189947656-189947678 TCCACAAGGCCTCTGCAGAGTGG - Intronic
985661975 5:1161897-1161919 TCACCAGGGCCAGGCCAGTGGGG + Intergenic
985920769 5:2971009-2971031 TCCCCAAGGGCAGTCCACAGTGG - Intergenic
992897112 5:81254894-81254916 TCCCCAGGGAAACTGCAGATTGG + Intronic
997009860 5:129863094-129863116 TCTCCAGGCCCTATCCAGAGTGG - Intergenic
997521110 5:134525326-134525348 TCCCCAGGGCCGGGCCCGAGCGG - Intronic
998885374 5:146688437-146688459 TCCTGAGACCCACTCCAGAGAGG - Intronic
999326635 5:150648239-150648261 TCCCCAGAGCCCCGACAGAGGGG + Exonic
1001198551 5:169695237-169695259 TCTACAGGGCCAATGCAGAGGGG - Intronic
1001316370 5:170643877-170643899 TCCCCAGGACCACTTGAGAGGGG - Intronic
1001576004 5:172764151-172764173 GCTCCAGAGCCACTCCGGAGGGG + Intergenic
1001872233 5:175166889-175166911 TCCCAAGGGACACTGCAAAGGGG - Intergenic
1002097239 5:176838770-176838792 TCCCCAGGGCTTTTCAAGAGAGG - Intronic
1002161955 5:177319487-177319509 TTCCCAGGGCCACTTTTGAGGGG - Intergenic
1002195844 5:177500900-177500922 TCCCCAGGGCCAGCACACAGTGG + Intergenic
1002207803 5:177575913-177575935 TTCCCGGGCCCACTCCAGTGGGG + Intergenic
1003640037 6:7868821-7868843 TCACCAGGGCTTCTGCAGAGGGG - Intronic
1006050277 6:31336863-31336885 TCCCTGGGGCCACTGCAGTGGGG + Intronic
1006399268 6:33807005-33807027 TTCCCAGGGCCCCTCCACACTGG + Intergenic
1007462834 6:42030672-42030694 TCCCCTGGGCCGCTCCAGGAAGG - Intronic
1009608246 6:65902361-65902383 TCCCTAAGGCCACTGTAGAGTGG - Intergenic
1011697992 6:89930523-89930545 GCCCGAGGGCCACTCCAGCCCGG - Exonic
1013267977 6:108518909-108518931 TCCCCAGGGACACTGTAAAGAGG - Intronic
1014018857 6:116565477-116565499 GCCGCAGGGCCAGGCCAGAGCGG - Intergenic
1016982397 6:149864643-149864665 CCCCCGGGACTACTCCAGAGAGG + Intergenic
1017407579 6:154136544-154136566 TCCCCCTGGCCATTCTAGAGAGG - Intronic
1020146993 7:5652282-5652304 TCCCCAAGATCACTCCAGACTGG + Intronic
1022104954 7:27190880-27190902 TTCCCCTGGCCACTGCAGAGTGG + Intergenic
1023756017 7:43417422-43417444 TCACCAGGCCCACTCTAGAAAGG - Intronic
1024256427 7:47543325-47543347 TCCCCAGGGCCATGCTGGAGGGG + Intronic
1024906870 7:54393178-54393200 TCCCCAGGGACTCTCCCAAGGGG - Intergenic
1025610650 7:63073238-63073260 TGCCCAGGGCCTCACAAGAGAGG + Intergenic
1025852148 7:65252263-65252285 TCCCCAGCGCGACTCCTCAGTGG - Intergenic
1026455809 7:70571694-70571716 TCCCCAAGGCTCCTCCACAGAGG - Intronic
1027229022 7:76261494-76261516 TCCCCTGGGCCACCCCAGGCAGG + Intronic
1027454036 7:78365159-78365181 TGTCCAGGGCTACTCCAAAGTGG + Intronic
1028907723 7:96173764-96173786 TCCCCAGGGCCACAGCTGACTGG + Intronic
1030077847 7:105751798-105751820 TCCCCAGGGGGACACCTGAGGGG - Intronic
1032656817 7:133939397-133939419 TCCCAAGGGCCAATGCAGGGTGG + Intronic
1033905163 7:146193254-146193276 TCCCCAGGGGCACTGCCTAGTGG - Intronic
1034533079 7:151708776-151708798 TCACCAAGGGCACTCCAGAGAGG - Intronic
1035027012 7:155832755-155832777 TCTCCAGGGTCACTCAAGACTGG - Intergenic
1035633533 8:1126854-1126876 TCCCCAGGGACAATCCAGTGAGG - Intergenic
1040547388 8:48409239-48409261 TCCACAGCTCCTCTCCAGAGAGG - Intergenic
1040549710 8:48428695-48428717 TCTCCAGGGACATTCCACAGAGG - Intergenic
1041104179 8:54425395-54425417 TCCCCTCGGCCCCTCCAGGGAGG + Intergenic
1042533053 8:69834045-69834067 TCCCCAGGCCCACGCTAGCGGGG - Intronic
1042585821 8:70336915-70336937 TTCACATGGCCCCTCCAGAGTGG - Intronic
1045131828 8:99163016-99163038 TCTCCAAGGCCCCACCAGAGCGG + Intronic
1046276269 8:111964638-111964660 TCCACAGGGCTAGTCCAGAAAGG - Intergenic
1046594696 8:116247772-116247794 CCTCCAGGGCCATGCCAGAGTGG - Intergenic
1048585926 8:135773794-135773816 TCCCCAGCGCCACTCATGGGGGG - Intergenic
1049691851 8:143965007-143965029 TCCACAGGGGCACACCAGGGTGG - Intronic
1050413681 9:5392183-5392205 TCCTCAGGACTACTCCGGAGAGG + Intronic
1052596986 9:30574401-30574423 TCGCAGTGGCCACTCCAGAGGGG - Intergenic
1053725788 9:40999094-40999116 TCCACAAGGCCTCTGCAGAGTGG - Intergenic
1054340151 9:63852773-63852795 TCCACAAGGCCTCTGCAGAGTGG + Intergenic
1060059255 9:120444401-120444423 TCCCCAAGCCCACACCAGATGGG + Intronic
1060219369 9:121756253-121756275 TCCCCAGGGCCACACAGCAGGGG + Intronic
1060656334 9:125374964-125374986 GCCCCAAGGCTCCTCCAGAGAGG - Intergenic
1061873318 9:133532001-133532023 TCCCCAGGGAACCTCCAAAGTGG + Intergenic
1062585423 9:137247323-137247345 GCCCGACGCCCACTCCAGAGAGG - Intronic
1202804391 9_KI270720v1_random:37582-37604 TCCACAAGGCCTCTGCAGAGTGG + Intergenic
1203449027 Un_GL000219v1:92864-92886 TCCACAGGGCCTCTGCAGAGTGG + Intergenic
1188262788 X:28038679-28038701 TCCCCAGGGACACTAATGAGTGG + Intergenic
1195613182 X:106892177-106892199 TCACCATGGCAACTCGAGAGCGG - Intronic
1198221087 X:134603193-134603215 TCCCCAGTCCCACTCCTCAGAGG - Intronic
1198694005 X:139316263-139316285 TCTCCAGAGCCATCCCAGAGAGG - Intergenic
1199050127 X:143228428-143228450 TCTCCAAGGCCCCACCAGAGCGG + Intergenic
1201499635 Y:14627718-14627740 CCGCCTGGGCCAGTCCAGAGAGG + Intronic