ID: 1096085208

View in Genome Browser
Species Human (GRCh38)
Location 12:48861120-48861142
Sequence TTCTGTCCTCCACTGAGGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096085201_1096085208 18 Left 1096085201 12:48861079-48861101 CCAATGAGCAAAACGCGGGTGCT 0: 1
1: 0
2: 0
3: 4
4: 18
Right 1096085208 12:48861120-48861142 TTCTGTCCTCCACTGAGGGGTGG 0: 1
1: 0
2: 2
3: 14
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096085208 Original CRISPR TTCTGTCCTCCACTGAGGGG TGG Exonic
900146288 1:1160288-1160310 CACTGACCTCCACTGAGCGGAGG - Intergenic
900516836 1:3086149-3086171 ATCTGTCCTGCCCTGAGAGGAGG - Intronic
900680932 1:3915781-3915803 TTCTCTCTGCCACCGAGGGGAGG - Intergenic
901147192 1:7073211-7073233 TGCTGTCATCTACTGAGGTGGGG + Intronic
901526286 1:9824849-9824871 GCCTTTCCTCCACTGCGGGGGGG - Intergenic
903049237 1:20588725-20588747 TTCTCTCCTTCACTGAGGGAAGG - Intergenic
903736634 1:25534157-25534179 GCGTGTCCTCCACTGTGGGGTGG - Intergenic
904052040 1:27645643-27645665 CTCTGTCCTGCCCTGAGGGAAGG - Intergenic
904455521 1:30645747-30645769 CTCTGTGCTTCACAGAGGGGTGG - Intergenic
907047791 1:51310360-51310382 TTCTGTCCTCCAGTCGGGTGTGG + Intronic
909607480 1:77521736-77521758 TTCAGTCATCCACTGAGGGAGGG - Intronic
914505156 1:148282190-148282212 ATCTGCCCCCCACTGAGGGGAGG + Intergenic
914507409 1:148301958-148301980 ATCTGCCCCCCACTGAGGGGAGG - Intergenic
918124957 1:181575176-181575198 TTCTGTCCTCCAGTGCAGGAGGG - Intronic
1066197279 10:33112727-33112749 TTCTCTTCTCCACTGCTGGGTGG + Intergenic
1066649447 10:37640581-37640603 TGCTGTTCTCCACTGGGGTGTGG - Intergenic
1067032335 10:42886122-42886144 TGCTGTGCTCCACTGGGGTGTGG - Intergenic
1067032666 10:42888812-42888834 TTCTTTCCTCCACTTAAGGAGGG - Intergenic
1068161434 10:53270280-53270302 TTCAGGCTTCCACTGGGGGGGGG - Intergenic
1068325181 10:55475902-55475924 TTCTGTTCTCCAATAAGGGCTGG - Intronic
1069927465 10:71860755-71860777 TTCTGACATCCACAGATGGGTGG - Intergenic
1070728218 10:78807020-78807042 TCCTGCCCTCCACTGAGGCCAGG + Intergenic
1071349271 10:84723247-84723269 TTTTCTCCTCCCCTGAGGTGAGG - Intergenic
1076211246 10:128646717-128646739 ATCTGTCCTCCTCTGAAGGAAGG - Intergenic
1076408630 10:130230611-130230633 AGCTGGCCTCCACTGAAGGGAGG + Intergenic
1076477638 10:130763681-130763703 GTCGGTCCTCCAGTGGGGGGAGG - Intergenic
1076534856 10:131170337-131170359 TTCTGTCTGCCACTCAAGGGAGG - Intronic
1077118132 11:894629-894651 TCCTGTCATCCCCTAAGGGGTGG - Intronic
1077246403 11:1541387-1541409 AGCTGTCCTCCACTGTGGGGTGG + Intergenic
1078577492 11:12514185-12514207 ATCTGTCCTACTCTGAGGGGTGG + Intronic
1081447696 11:43146226-43146248 TTCTCTCCTTCACTAAGGAGGGG - Intergenic
1083712593 11:64558433-64558455 GTCCGTCCTCCACTGAGGCCCGG - Intronic
1083798896 11:65035046-65035068 TTCTGTCCTGCAGGGTGGGGAGG + Exonic
1085442670 11:76578370-76578392 TTCTGTCTCCCACTAAGGGCTGG - Intergenic
1085481218 11:76824399-76824421 ATCTGTCATGCACTGAGAGGGGG - Intergenic
1089166865 11:116484029-116484051 TTCTGTCCTCCCCTGAGAGGTGG - Intergenic
1091994389 12:4981857-4981879 TTCTGTCCTCCACTTTTTGGAGG - Intergenic
1093401504 12:18752627-18752649 TTCAGTCCTCCAGGGAGGGTGGG - Intergenic
1093742659 12:22706230-22706252 ATCTGTCCTCTAGTTAGGGGAGG + Intergenic
1095736004 12:45556926-45556948 TTCTGGTTTCCAGTGAGGGGTGG - Intergenic
1095951528 12:47784329-47784351 GCCTGTCCTCCACTTAGGGTCGG + Intronic
1096085208 12:48861120-48861142 TTCTGTCCTCCACTGAGGGGTGG + Exonic
1096229389 12:49888844-49888866 TCCCGTCCTCCTCTGTGGGGTGG - Intronic
1096845048 12:54401845-54401867 TTCTGTCCCCAGCTGTGGGGTGG - Exonic
1097101785 12:56594880-56594902 TACTGTCCTTCTCTGAGGGTTGG + Exonic
1097106996 12:56631845-56631867 TTCCTTACTCCACAGAGGGGTGG + Intronic
1098550651 12:71757506-71757528 CACTGTACTCCACAGAGGGGAGG + Intronic
1102411675 12:112725587-112725609 CTCTGTCCTCTACTCAGGAGTGG + Intronic
1102866872 12:116381778-116381800 TTGTCTCCTGCAATGAGGGGCGG - Intergenic
1104982535 12:132580648-132580670 TTCTGGTCTCCACTGAGCTGTGG - Intronic
1105300366 13:19128483-19128505 TTCATTCCTCCACTGGTGGGGGG + Intergenic
1105634881 13:22207637-22207659 TTCTCTCCAGCCCTGAGGGGTGG - Intergenic
1107851866 13:44578233-44578255 TTCTGTCCTCCAGTTAAGGATGG - Intergenic
1108048033 13:46401780-46401802 TTCTGTACTCCACTGGGGGTTGG + Intronic
1109670537 13:65600822-65600844 TTCTGCCCTAGACTTAGGGGAGG - Intergenic
1113747384 13:112754658-112754680 TTCTGTACTCCACTCACAGGTGG + Intronic
1114307485 14:21437161-21437183 CTCTCTCCTCCACTGGGGTGAGG - Intronic
1114334262 14:21671610-21671632 GTCTGCCCTCAGCTGAGGGGTGG - Intergenic
1115553760 14:34527557-34527579 TCCTTTCATCCACTGAGGGATGG - Intronic
1116631692 14:47343342-47343364 TTCTGTCCTCCTTTGAGCTGTGG - Intronic
1116996924 14:51334322-51334344 TTGTTTCCTCCAGTGAGGGCAGG + Intergenic
1119386649 14:74261505-74261527 ATCTGGACTCCACTGATGGGTGG - Exonic
1120513647 14:85445134-85445156 ATCTGTGCTCCACTGTGGGGTGG - Intergenic
1120636347 14:86956115-86956137 TCCTGTTTTCCACTGAGGGACGG - Intergenic
1121308276 14:92921038-92921060 TTCTGTCCTCCAGGGAGGCCAGG + Intergenic
1123783789 15:23648637-23648659 TGCTGTCTTCCACTGATGTGTGG - Intergenic
1125526043 15:40375519-40375541 TTTTTTTGTCCACTGAGGGGTGG - Intergenic
1127758328 15:62113957-62113979 TTCTGTCCTGCCCTGAGGGCAGG - Intergenic
1128635585 15:69300031-69300053 TTTTCTCCACCACTGAGTGGCGG + Intronic
1129322559 15:74782973-74782995 CTCTGAGCTCCACAGAGGGGGGG - Intronic
1130597657 15:85258270-85258292 TTCTGACCTCCAGTGAGTAGAGG - Intergenic
1130842787 15:87717218-87717240 TTCTGTCCTCAGCATAGGGGTGG - Intergenic
1133981465 16:10635958-10635980 TTCTGACCTCCTCTGACTGGGGG + Intronic
1136012989 16:27376571-27376593 TTCTGCCCCCCATCGAGGGGAGG - Intergenic
1138366977 16:56488168-56488190 TTCTGTCCTCAACTGTGTGGAGG + Intronic
1138824572 16:60303703-60303725 TTCTGCCCTCCAGTGTGGGCTGG + Intergenic
1139464651 16:67147903-67147925 TTCTGTTCTGCACTGTGGGCTGG + Exonic
1141570268 16:84929871-84929893 TTCTGTCCTCAGCTGATGGTAGG + Intergenic
1141985587 16:87577566-87577588 GTCTGTGCCTCACTGAGGGGTGG - Intergenic
1144485266 17:15659291-15659313 TTTTGTCTTCCAGTGAGGTGTGG + Intronic
1144608382 17:16687620-16687642 TCCTCTTCCCCACTGAGGGGCGG + Intergenic
1144909608 17:18670627-18670649 TGCTGTCCTCCACTGGCAGGCGG + Intronic
1145196459 17:20898646-20898668 TCCTCTTCCCCACTGAGGGGCGG - Intergenic
1146656674 17:34638701-34638723 TTCTGTCCTGCAGGGTGGGGAGG + Exonic
1148829171 17:50419155-50419177 TTCTTTCAACCACTGTGGGGAGG + Intergenic
1152277681 17:79367686-79367708 GCCTGTCCTCCCCGGAGGGGTGG - Intronic
1152545441 17:80998008-80998030 TGGTGTCCACCACTGCGGGGTGG - Intronic
1152708025 17:81855399-81855421 TTCCGTCATCCATTGAGGAGGGG - Intronic
1153991360 18:10403557-10403579 TTCTGTCTCCCTCTGAGGTGGGG + Intergenic
1155264908 18:24082680-24082702 TTCTCTTCTCCCCTGAGGGAAGG + Intronic
1155855412 18:30828613-30828635 TTCTGTCCTCAACTAATGGTAGG + Intergenic
1156097822 18:33557165-33557187 TACTGTTATTCACTGAGGGGTGG + Intergenic
1156839168 18:41590994-41591016 TTCTGGCCTCTGCTGAGTGGTGG - Intergenic
1164121770 19:22272308-22272330 TTCTCTCAACCACTGTGGGGTGG + Intergenic
1164626365 19:29731228-29731250 TTCAGTCCTTCTCTGAGGGAAGG + Intergenic
1166251751 19:41576237-41576259 CTCTGTCCTCCTCTGTGGAGAGG - Exonic
1167691978 19:50991116-50991138 TGCTCTCCTCCACTTTGGGGAGG - Intergenic
1167717472 19:51153119-51153141 CTCTTTCCTCCCCTGAGGAGTGG - Exonic
1168412779 19:56150022-56150044 TTCTGTCTGCCACAGAGGCGAGG + Intronic
1168521460 19:57054144-57054166 CTCTGTCTTCCACTTAAGGGAGG + Intergenic
925064908 2:922244-922266 TGCTGGCATCCAGTGAGGGGAGG + Intergenic
925155437 2:1645858-1645880 TTCTGTCCCCCACCGCTGGGAGG + Intronic
928236086 2:29542026-29542048 TTCTGCATCCCACTGAGGGGTGG + Intronic
929523683 2:42679317-42679339 TTCTGTGCTCAACTAAGGCGGGG + Intronic
932881841 2:75508911-75508933 TCTTTTCCTCCTCTGAGGGGAGG + Intronic
934735442 2:96687630-96687652 TTCTGCCCTCCAGAGTGGGGTGG - Intergenic
934755904 2:96824713-96824735 TTGTGTTCTCCACTGGAGGGAGG + Intronic
935721642 2:105985040-105985062 TTCTCTCAACCACTGTGGGGCGG + Intergenic
936780444 2:116026561-116026583 TTCTGTCCTCCACATAAAGGTGG + Intergenic
937712592 2:124995392-124995414 TTCTGAGCCACACTGAGGGGTGG + Intergenic
938599782 2:132825381-132825403 TTTTGTCTTCCTCTTAGGGGTGG - Intronic
939617483 2:144377540-144377562 TTCTGTTGTCCACTCATGGGTGG + Intergenic
945129732 2:206557743-206557765 TTTTGTCCTCCACAGACTGGGGG - Intronic
946948109 2:224843174-224843196 TTCCCTTCTCCACTGAGGAGGGG + Intronic
1169017785 20:2305751-2305773 TGCAGTCCTCCACTGTGGAGTGG + Intronic
1169408511 20:5347041-5347063 CTCTGCTCTCCACTGAGGGAGGG - Intergenic
1171190913 20:23158799-23158821 TGATGTCCTCCATTGAGGAGGGG - Intergenic
1171344922 20:24458854-24458876 TTCTATTCTCAACTGAGAGGGGG + Intergenic
1172304464 20:33871349-33871371 TACTGTCCTCGGCAGAGGGGAGG + Intergenic
1175873445 20:62218978-62219000 TTCTTTCCTCCTTTGAGGGCTGG - Intronic
1175876879 20:62234480-62234502 CTCTGCCCTTCACTGCGGGGTGG + Intronic
1179451514 21:41471582-41471604 TTCTGTACTGTACTGAGTGGTGG - Intronic
1179604244 21:42502826-42502848 TTCTGTGCGACACTGTGGGGTGG - Intronic
1181042797 22:20200549-20200571 CTCCCTCCTCCACTGAGGGCAGG - Intergenic
1181320763 22:22004330-22004352 TTCAGTGCTCCACTGTGGGTGGG - Intergenic
1183440556 22:37820627-37820649 TTCTGTCCTGAACTGTGTGGAGG - Intergenic
1184656594 22:45944876-45944898 CACTGTCCTCCAGTGTGGGGTGG - Intronic
1184718171 22:46293806-46293828 TTCAGCCCTCCTGTGAGGGGCGG + Exonic
949227149 3:1708941-1708963 TTTTGAACCCCACTGAGGGGTGG - Intergenic
950140682 3:10613027-10613049 GCCTGGCCTCCACCGAGGGGAGG + Intronic
952421327 3:33133930-33133952 GTTTGTCTTCCACTGAGGGCTGG + Intronic
952860921 3:37811629-37811651 CTCTCTCCTTCACTGAGTGGTGG - Intronic
952964007 3:38610010-38610032 CTCTGTGCTCCACTGGTGGGGGG + Intronic
954789337 3:53119590-53119612 TGGGGTGCTCCACTGAGGGGTGG + Intronic
956075101 3:65496647-65496669 CTCTGTCCTCCATTGGTGGGTGG - Intronic
956674804 3:71724323-71724345 TTTTATCCTTAACTGAGGGGAGG + Intronic
957999128 3:87729646-87729668 TTCTGTACTCCATTGGGGGATGG - Intergenic
959223783 3:103555651-103555673 TTCTGTCCGCTACTCAGGTGTGG + Intergenic
960298125 3:115968600-115968622 TTCTCTCCTCAACAGAGGGAAGG + Intronic
960520160 3:118645633-118645655 TTCTGTCTTCCACAGAGAAGAGG + Intergenic
960895634 3:122501790-122501812 TTCTGTCCTCTACTGAAAGTGGG + Intronic
962855467 3:139340936-139340958 TTCTGTTCACCACTGGGGGTTGG - Intronic
963804940 3:149713944-149713966 TGCTGGCCACCACTGCGGGGAGG + Intronic
964430976 3:156605794-156605816 TTCTCTCCTCTGCTGAGGGCTGG + Intergenic
964496431 3:157295633-157295655 TCCAGTTCTCTACTGAGGGGTGG - Intronic
964707768 3:159638423-159638445 TAATGTGCTCCACTTAGGGGTGG - Intronic
965832993 3:172816756-172816778 TTCTTCCCTCCACTGAGCCGTGG - Exonic
966463390 3:180202777-180202799 TTCAGTCATTCTCTGAGGGGAGG - Intergenic
967014976 3:185473523-185473545 TTCTGGCCTGCACTGAAGGCAGG - Exonic
967532370 3:190563623-190563645 TTCTGTCTTCCAGTGAGAAGAGG + Intronic
969965780 4:10993913-10993935 TTCTGTCTTCCACTTAAGGATGG + Intergenic
970969384 4:21963797-21963819 TTCTATCCACCACTCAGAGGAGG + Intergenic
971308219 4:25502171-25502193 TTCTGTGGTTCCCTGAGGGGTGG - Intergenic
972641796 4:40932182-40932204 CTCTGTCCACCACTAAGGGCTGG - Intronic
976907407 4:90257017-90257039 TTCAGGCATCCACTGCGGGGGGG + Intronic
980758600 4:137198733-137198755 TTCTGTCCTCCAGAGAGGCAAGG - Intergenic
981748018 4:148069376-148069398 TTCTGCCTTCCAGGGAGGGGAGG + Intronic
983998324 4:174212631-174212653 TTCTGTCCCTCACTGAGAGAGGG - Intergenic
986487879 5:8258597-8258619 TTATGTCCTGCACTGGGGGCTGG + Intergenic
987663102 5:20903365-20903387 TAATGTCCTCCCTTGAGGGGAGG - Intergenic
987717565 5:21592203-21592225 TTCTTTCCTCCCCAGAGGTGAGG - Intergenic
988759585 5:34298817-34298839 TAATGTCCTCCCTTGAGGGGAGG + Intergenic
991437476 5:66611437-66611459 TTCTGTCCTCCTCTCATGAGAGG + Intronic
992004131 5:72461181-72461203 TTTTGTTCTCCTCTGAGTGGAGG + Exonic
995384460 5:111573546-111573568 ATCTGTCTTCAACTGTGGGGTGG - Intergenic
997952333 5:138252522-138252544 TTCCATCCTCCACTCAGAGGAGG + Exonic
999291776 5:150430496-150430518 TGCTGGCCTCCACTGAGATGGGG + Intergenic
999868984 5:155729981-155730003 CTCTGTACTCCACTGAAGGGAGG + Intergenic
1002087004 5:176782165-176782187 GTCTGGCCTGCACAGAGGGGAGG + Intergenic
1003369215 6:5508564-5508586 TGCTTTCCTCCACTGCTGGGAGG - Intronic
1006200038 6:32279926-32279948 GTCTGTCAACCACTGATGGGAGG - Intergenic
1007503447 6:42316034-42316056 TTCTCTGCTCCACTGGGGGTGGG + Intronic
1007729590 6:43937885-43937907 TTGTGTCCTCCACTCAGGCTGGG + Intergenic
1007740251 6:44005451-44005473 GTCTCCCCTCCACTGAAGGGAGG - Exonic
1009668755 6:66717843-66717865 ATCTGTCCATCACTGAGGGGTGG - Intergenic
1013285766 6:108680047-108680069 TGCTGTCCTCCACTGGCAGGCGG - Exonic
1013327466 6:109061918-109061940 TTCTGTCCTCCACTAAAGTGAGG - Intronic
1013343569 6:109238104-109238126 CACTGTCCTCCACTGTGCGGAGG + Intergenic
1015134972 6:129858504-129858526 TTCTGTCCTGCAGTGAGGGGTGG - Intronic
1016940369 6:149478234-149478256 TTCTGTCGTACACTCAGGAGAGG - Intronic
1018141007 6:160837325-160837347 CTCTGTCCTCCGCTCCGGGGAGG + Intergenic
1018818094 6:167350960-167350982 CTCTGTCCTCCGCTCCGGGGAGG - Intronic
1019090354 6:169526003-169526025 TTCTGTCCTCCACATATGAGGGG - Intronic
1019189004 6:170239104-170239126 TTCTCTCTTCCACTGTGGGCTGG - Intergenic
1020451285 7:8323262-8323284 CCCTTTCCTCCACTGAGGTGGGG - Intergenic
1020665250 7:11033104-11033126 TTCTGTCTTCCACTGGGAGTAGG + Intronic
1026626688 7:71999390-71999412 TTCTGTCCTTTGCTGAGAGGTGG - Intronic
1027877653 7:83791291-83791313 TTCTGGCCTGCACTGCGGGGAGG - Intergenic
1028367463 7:90050413-90050435 CTCTGTGCTTAACTGAGGGGAGG + Intergenic
1031034308 7:116771097-116771119 TTCTGTCCTGGACGGTGGGGTGG - Intronic
1033787046 7:144744658-144744680 TTCTGACTTCCAGTGAAGGGAGG - Intronic
1034228334 7:149499673-149499695 CTCTGTCCTCCACTGAAGACAGG + Intergenic
1034645024 7:152638652-152638674 TACTCTCCTCCTCTGAGGGTAGG + Intergenic
1036416616 8:8555272-8555294 TGCTGTGCTCCTCTGAGTGGTGG - Intergenic
1036449337 8:8852111-8852133 TTCTGTCCTCCAGAGAGCTGAGG + Intronic
1038338050 8:26661369-26661391 TTCTGTCCCGCCCTGAGTGGAGG - Intergenic
1039506261 8:38054626-38054648 ATCTCTCCTCCCCAGAGGGGAGG - Intronic
1040981933 8:53252724-53252746 TTCTGCCCTCCGCTGATGGAGGG - Intergenic
1041154710 8:54973361-54973383 CTCTTTCCTCCACTCAGGAGAGG - Intergenic
1042566675 8:70118387-70118409 TTCTCTCCTCCACTGAGTACAGG - Intronic
1043937139 8:86155150-86155172 TGCTGTCCTTCACGGGGGGGTGG + Intergenic
1047249495 8:123171014-123171036 CTCTGTCCTCCCCAGAGGGTAGG - Intergenic
1048405349 8:134113765-134113787 TTCTGTCCCCAAGTGTGGGGAGG + Intergenic
1051950360 9:22623420-22623442 TTCTGCCCCACAGTGAGGGGTGG + Intergenic
1056661163 9:88544366-88544388 TTCTGTCCTGCAGTGAGCTGAGG + Exonic
1056814179 9:89789710-89789732 CTGTGTCTCCCACTGAGGGGAGG - Intergenic
1057754435 9:97820535-97820557 TGCTGTCCTTCCCTGAAGGGGGG + Intergenic
1061147454 9:128808228-128808250 TCCTGGGCTCCACTCAGGGGAGG + Exonic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1186853608 X:13604420-13604442 TTCTGCCCTTCATTGATGGGAGG + Intronic
1187677314 X:21729425-21729447 TACTGTCCTCTAGTGAGGAGAGG - Intronic
1190398623 X:50009805-50009827 TTCTGTTCTCCACGCAGAGGGGG - Intronic
1191030281 X:55962145-55962167 ATCTGGGCTCCATTGAGGGGAGG - Intergenic
1192592248 X:72370028-72370050 TTCTGTTCCCCAATAAGGGGTGG - Intronic
1193151131 X:78125574-78125596 TCCTGGCATCCACTGAGGCGGGG + Intronic
1197483033 X:127010813-127010835 TTCAGTCTACCACTGATGGGCGG - Intergenic
1199380409 X:147165590-147165612 GTCTGGTCTCCACTCAGGGGTGG + Intergenic