ID: 1096087248

View in Genome Browser
Species Human (GRCh38)
Location 12:48874013-48874035
Sequence AAGAAGAAGAAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096087244_1096087248 7 Left 1096087244 12:48873983-48874005 CCCAAAAAAAAAAAAGAAGAAGA 0: 38
1: 204
2: 1950
3: 19436
4: 30458
Right 1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG No data
1096087245_1096087248 6 Left 1096087245 12:48873984-48874006 CCAAAAAAAAAAAAGAAGAAGAA 0: 31
1: 169
2: 1378
3: 18009
4: 28698
Right 1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096087248 Original CRISPR AAGAAGAAGAAGAATGAGGA GGG Intergenic
No off target data available for this crispr