ID: 1096089513

View in Genome Browser
Species Human (GRCh38)
Location 12:48889577-48889599
Sequence AGAACCTGAAAACAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096089513_1096089515 26 Left 1096089513 12:48889577-48889599 CCTTCCAGCTGTTTTCAGGTTCT No data
Right 1096089515 12:48889626-48889648 ATCACTGATCCACCTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096089513 Original CRISPR AGAACCTGAAAACAGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr