ID: 1096089514

View in Genome Browser
Species Human (GRCh38)
Location 12:48889581-48889603
Sequence TCTCAGAACCTGAAAACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096089514_1096089515 22 Left 1096089514 12:48889581-48889603 CCAGCTGTTTTCAGGTTCTGAGA No data
Right 1096089515 12:48889626-48889648 ATCACTGATCCACCTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096089514 Original CRISPR TCTCAGAACCTGAAAACAGC TGG (reversed) Intergenic
No off target data available for this crispr