ID: 1096090329

View in Genome Browser
Species Human (GRCh38)
Location 12:48895358-48895380
Sequence CTGCAGAAACACATTCAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096090328_1096090329 15 Left 1096090328 12:48895320-48895342 CCTTATCTCAAAACAATAAAATA No data
Right 1096090329 12:48895358-48895380 CTGCAGAAACACATTCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096090329 Original CRISPR CTGCAGAAACACATTCAGAT AGG Intergenic
No off target data available for this crispr