ID: 1096090329 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:48895358-48895380 |
| Sequence | CTGCAGAAACACATTCAGAT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1096090328_1096090329 | 15 | Left | 1096090328 | 12:48895320-48895342 | CCTTATCTCAAAACAATAAAATA | No data | ||
| Right | 1096090329 | 12:48895358-48895380 | CTGCAGAAACACATTCAGATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1096090329 | Original CRISPR | CTGCAGAAACACATTCAGAT AGG | Intergenic | ||
| No off target data available for this crispr | |||||