ID: 1096096759

View in Genome Browser
Species Human (GRCh38)
Location 12:48940579-48940601
Sequence CTTGGTTACAGTTTGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096096759_1096096768 25 Left 1096096759 12:48940579-48940601 CCCTTCAGCAAACTGTAACCAAG 0: 1
1: 0
2: 1
3: 9
4: 181
Right 1096096768 12:48940627-48940649 AGTAATTCCAAGCCTTTGGCAGG 0: 1
1: 0
2: 2
3: 99
4: 3175
1096096759_1096096766 21 Left 1096096759 12:48940579-48940601 CCCTTCAGCAAACTGTAACCAAG 0: 1
1: 0
2: 1
3: 9
4: 181
Right 1096096766 12:48940623-48940645 CCCAAGTAATTCCAAGCCTTTGG 0: 1
1: 0
2: 0
3: 15
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096096759 Original CRISPR CTTGGTTACAGTTTGCTGAA GGG (reversed) Intronic
902113813 1:14104792-14104814 CTTGTTTTGTGTTTGCTGAATGG + Intergenic
902397881 1:16142456-16142478 CTCAGTTAATGTTTGCTGAATGG + Intronic
905992725 1:42353357-42353379 CTTGGTTGAAGTTTGCTCTACGG - Intergenic
906166635 1:43691238-43691260 CTTGGTTGCAGATAGCAGAAAGG + Intronic
910255670 1:85244834-85244856 CTTGTTTACCATTTTCTGAAAGG - Intergenic
911187759 1:94920471-94920493 CATGGTTTCATTTTGCTGACTGG - Intronic
912180451 1:107212911-107212933 CTTGGTAACAGGCTTCTGAATGG - Intronic
917447148 1:175115869-175115891 CTTGCTTACGTTTTGCTGTAGGG + Intronic
917536039 1:175875417-175875439 CTTGGTTTCAGTTTTGGGAAGGG - Intergenic
921908485 1:220521709-220521731 AATGGTTTCAGTCTGCTGAAAGG + Intergenic
922388389 1:225112848-225112870 CTTTGTTAAATTTTTCTGAAAGG + Intronic
1063768700 10:9172838-9172860 CTTGGTTTTAGTTTTCAGAAAGG + Intergenic
1065178628 10:23103097-23103119 ATTGCTTACATTTTGCTAAAAGG - Intronic
1065696616 10:28386456-28386478 CTTGCTTTCAGTTTACTGCAAGG + Intergenic
1067434269 10:46266021-46266043 CTTGGTGACAGCCTGCTGAGAGG + Intergenic
1072448913 10:95523373-95523395 CTTGGCTGCAGTCTGCTGCAGGG - Intronic
1075364136 10:121868327-121868349 CTTGGATAAAGTATGATGAAAGG - Intronic
1075703260 10:124482999-124483021 CTCAGTGACAGTTTGCAGAAGGG + Intronic
1077933385 11:6756911-6756933 CTTTAGTAAAGTTTGCTGAATGG + Intergenic
1079142963 11:17825428-17825450 CTTGGTTCTTGTTTTCTGAAAGG + Intronic
1087104277 11:94394741-94394763 CTTGTGTTCAGATTGCTGAAGGG + Intronic
1088314022 11:108488909-108488931 CTTGGGTAAAGTATGCAGAAGGG + Intronic
1092966420 12:13647895-13647917 ATTGGTTTCAGTTGGATGAAAGG + Intronic
1093016534 12:14161115-14161137 CTTGTTTACTGTTTGAGGAAAGG + Intergenic
1093047346 12:14463670-14463692 CCTGGTTACAGTATGGAGAATGG + Intronic
1094709558 12:32947876-32947898 CTAGGTTACAGTGTGATGCATGG + Intergenic
1096096759 12:48940579-48940601 CTTGGTTACAGTTTGCTGAAGGG - Intronic
1096654034 12:53077403-53077425 CTTGGTAAATGTTTGTTGAATGG - Intronic
1099660446 12:85551795-85551817 CTTGATAAATGTTTGCTGAATGG - Intergenic
1104072229 12:125355962-125355984 CTTGATGACCCTTTGCTGAAGGG - Intronic
1105276094 13:18928349-18928371 CCTTGTGACAGTTTGCTGTAGGG - Intergenic
1105448697 13:20479338-20479360 CTTGATAACATTTTGCTGAGTGG - Intronic
1107019969 13:35741270-35741292 CTTGCTTTCAGTTTACTGTATGG - Intergenic
1108737424 13:53298745-53298767 CTTGGTTTCAGTTTACTCTATGG + Intergenic
1109608105 13:64725695-64725717 ATTGGTTACAGCTCGCTGTATGG - Intergenic
1110031657 13:70622651-70622673 TTTGGTTATAATTTCCTGAAAGG + Intergenic
1111014573 13:82362173-82362195 CTTGTTTTAAGTTTGCTGACAGG - Intergenic
1115264927 14:31491509-31491531 CTTGGAAACAGTATGCTTAAAGG + Intronic
1115322508 14:32098922-32098944 CTCGGTTACAGTGTGAAGAATGG + Intronic
1116239461 14:42322724-42322746 CTTGCTTACAGTAAGCTGACTGG + Intergenic
1117740737 14:58816813-58816835 CTGTGTTACACTTTGCTGGATGG - Intergenic
1119444457 14:74651759-74651781 CTTGGTTTGTCTTTGCTGAATGG + Intergenic
1120245015 14:81996061-81996083 CTTGGCTATAATTTGCTGATGGG + Intergenic
1121414156 14:93767510-93767532 CTTGGCATGAGTTTGCTGAAGGG - Intronic
1121448516 14:93993466-93993488 CTGAGTTTCAGTTTCCTGAAAGG - Intergenic
1121643852 14:95504408-95504430 TTGTGTCACAGTTTGCTGAAAGG - Intergenic
1121760949 14:96444527-96444549 CTTAGTTTCAGTTTGGTGACTGG - Intronic
1123426982 15:20180644-20180666 CATGGTTACTGTTTACTGCAGGG + Intergenic
1123536213 15:21187153-21187175 CATGGTTACTGTTTACTGCAGGG + Intergenic
1125413215 15:39426647-39426669 CTTGGTAAATATTTGCTGAACGG - Intergenic
1126065253 15:44821620-44821642 ATTTGTTAAAGTTTGGTGAATGG + Intergenic
1126094576 15:45078963-45078985 ATTTGTTAAAGTTTGGTGAATGG - Intergenic
1126777008 15:52109075-52109097 GTGGGTGACAGTTTGCAGAATGG + Intergenic
1132167929 15:99614545-99614567 CTTGGTTACAGTTTGGTTGGGGG + Intronic
1134464021 16:14457041-14457063 CTTGGCCAAGGTTTGCTGAATGG + Intronic
1135050963 16:19192747-19192769 CTTGTTTATAGTTTCCTCAAAGG - Intronic
1135251518 16:20904239-20904261 CTTGGTTACAGTAGCCTGATTGG + Intronic
1136857316 16:33669192-33669214 CATGGTTACTGTTTACTGCAGGG - Intergenic
1138138056 16:54540997-54541019 CTGGGTTACTGTTTGCTCAGAGG - Intergenic
1203118889 16_KI270728v1_random:1517683-1517705 CATGGTTACTGTTTACTGCAGGG - Intergenic
1145220805 17:21086876-21086898 ATTGGTTACAGTTTGCACAAAGG - Intergenic
1146067562 17:29648572-29648594 CCTGGTAAATGTTTGCTGAATGG - Intronic
1146747752 17:35346808-35346830 CTCGGTGACTTTTTGCTGAATGG - Intergenic
1146763335 17:35496839-35496861 CTTGGTGACTTTTTGCTGAATGG - Intronic
1146792818 17:35762409-35762431 CCTGGTGAATGTTTGCTGAATGG + Intronic
1148518430 17:48244594-48244616 ATTTGTTAATGTTTGCTGAAAGG - Intronic
1149106070 17:52966973-52966995 CTTGTACACAGTTTGTTGAATGG - Intergenic
1151299878 17:73216329-73216351 TTTGGGAACTGTTTGCTGAATGG + Intronic
1153148298 18:2058392-2058414 CTTGCTTTCACTTTGCTGTATGG - Intergenic
1154315280 18:13299149-13299171 CTTGCTTACACTGTGCTGGATGG + Intronic
1154532924 18:15365786-15365808 CTTAGTGAGAGTTTGCTGAGTGG - Intergenic
1157596294 18:48865991-48866013 CTTTGTTACAGATGCCTGAATGG - Intergenic
1159165537 18:64694458-64694480 CTAGGTTTCAGTTTGCTACATGG - Intergenic
1164201928 19:23026217-23026239 CTTGGTTTCACTTTACTGCATGG + Intergenic
1165407177 19:35638008-35638030 CTTGGTGAGAGTCTGCTGGATGG - Intergenic
1165709698 19:38001947-38001969 CTTTTTTACAGTTTCCTTAAAGG - Intronic
1167550697 19:50158735-50158757 CATGGTCACAGTTTACTGAAAGG - Intronic
1167691708 19:50988791-50988813 CTTGGATACAGGTGGTTGAAAGG + Intergenic
931024887 2:58100151-58100173 CTTGTTTACTGTTTGCTGAAGGG + Intronic
931159928 2:59677848-59677870 ATTGTTTATAGTTTGCTGTATGG + Intergenic
932806104 2:74784800-74784822 CTGGGGTCCAGTTTGATGAATGG + Intergenic
933459727 2:82566863-82566885 CTTGGTTACAGATAGCTGCAAGG + Intergenic
935842431 2:107128099-107128121 CTGCTTTACAATTTGCTGAAAGG - Intergenic
935844537 2:107150901-107150923 CCTTGTTACAGTTTGTTTAAAGG - Intergenic
935848897 2:107197675-107197697 CTTGTTTACATTTTGCAGAGAGG - Intergenic
935927788 2:108089183-108089205 CTAGGTAAAAGTTTGCTGTAGGG + Intergenic
936482836 2:112901042-112901064 CTAGATTACAGTTTCCTCAAGGG + Intergenic
936692678 2:114911554-114911576 TTTGGATACAGTTTTCAGAAGGG + Intronic
938532025 2:132197039-132197061 CTTAGTGAGAGTTTGCTGAGTGG - Intronic
938748508 2:134305013-134305035 CTTGGGTACGGTTTGAAGAAAGG - Intronic
940273583 2:151916562-151916584 CTTGATTACAAATTGTTGAAGGG + Intronic
940911021 2:159210129-159210151 CTCAGTTCCAGTTTGCAGAATGG + Intronic
941542407 2:166803206-166803228 AGTGGTTACAGTTTGCTTATGGG - Intergenic
941968295 2:171322417-171322439 CTTGTTTTCACTTTGCTGTATGG - Exonic
945279121 2:208018704-208018726 TTTGGTTGCAGTGTGGTGAATGG - Intronic
945355074 2:208830661-208830683 CTTGGGTCCAGGTGGCTGAATGG + Intronic
945365465 2:208947412-208947434 TTTTGTTACAGTTGCCTGAAGGG + Intergenic
945489244 2:210435448-210435470 CTCATTTTCAGTTTGCTGAATGG - Exonic
947043630 2:225952211-225952233 CTTTGTTAAAGTATCCTGAATGG + Intergenic
1168884476 20:1237484-1237506 CTCGGTTACTGTTAGCTGACTGG + Intronic
1174148110 20:48466623-48466645 CATGGTCACAGCTTGCTGCAAGG + Intergenic
1175339819 20:58221542-58221564 CGTGGCTACATTTTGCTGGACGG + Intronic
1176764433 21:13002414-13002436 CTTAGTGAGAGTTTGCTGAGTGG + Intergenic
1176985811 21:15434313-15434335 CATGGTTACAATTTACAGAAAGG + Intergenic
1181633291 22:24162549-24162571 TCTGGTAACAGTGTGCTGAAGGG - Intronic
1182840445 22:33385149-33385171 CTTGGTTACTTTCTGCGGAAGGG + Intronic
949132778 3:525433-525455 CTTGTTTACTGTCTGCCGAATGG + Intergenic
949273225 3:2245782-2245804 CATAGTTACAGGTAGCTGAAAGG - Intronic
953750943 3:45607874-45607896 CTTGGTTCCACCCTGCTGAAAGG - Intronic
955046993 3:55369920-55369942 CTTGGTTAGAGTCTCATGAAGGG - Intergenic
955908684 3:63835406-63835428 CAGTGTTACATTTTGCTGAATGG + Intronic
956150041 3:66231306-66231328 CTTAGTTACCGTTTGCTGAGTGG + Intronic
956238353 3:67101411-67101433 CTATGTTCCATTTTGCTGAATGG - Intergenic
957470625 3:80653778-80653800 CTGGGTGAAAGTTTGCTGCAGGG + Intergenic
958839654 3:99187866-99187888 CTTTGTTACATTTCGCTGATAGG - Intergenic
959692510 3:109213495-109213517 ATTGCTAACAGTTTGCTGACTGG - Intergenic
961124516 3:124404405-124404427 CTTGGTCACTGTCTGCTGAATGG + Intronic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
963446650 3:145418929-145418951 ATTAGTTACAGTTGACTGAAGGG + Intergenic
963580088 3:147115306-147115328 CTTTGTTACAGGTTCTTGAAAGG - Intergenic
964669069 3:159205398-159205420 CTTGGATACAGTTTCCTGGTTGG - Intronic
966980652 3:185131354-185131376 CTTGGTTACTTTTTGTTGAGTGG - Intronic
967497700 3:190160628-190160650 CTCAGCTACAGTTTGCTGGAGGG - Intergenic
970591940 4:17567374-17567396 TTTGGTTACAGATTGCTACATGG + Intergenic
970695667 4:18674021-18674043 CTTGGTTGCAGTGTGGAGAATGG + Intergenic
973775463 4:54237518-54237540 CTTGTTTGAAGTTTGCTGAGTGG + Intronic
973810655 4:54566824-54566846 CTTGGTTTCACTTTCCTGCAAGG + Intergenic
976418329 4:84806271-84806293 CTTGCATACATTTTGCTCAATGG - Intronic
977753226 4:100634365-100634387 ATTGGTTACATTATGCTGACTGG - Intronic
978082784 4:104615560-104615582 GTAGGTGACAGTTTCCTGAATGG + Intergenic
978263704 4:106795512-106795534 CTTGGTTAAAATGTGCTGACAGG + Intergenic
979987375 4:127331770-127331792 CTTTGTTACAGTTTGGTGGCTGG + Intergenic
984017320 4:174441700-174441722 CTAGGCAAAAGTTTGCTGAAGGG - Intergenic
984582240 4:181523700-181523722 CTTGGTTAGAGCTTGCTTTAAGG - Intergenic
985154988 4:186978231-186978253 CATGATCACAGTTAGCTGAAAGG - Intergenic
985768400 5:1794145-1794167 CTTGGTTACCATTTGTTGCAGGG + Intergenic
986113070 5:4739361-4739383 CTCGGGCACAGGTTGCTGAAGGG - Intergenic
987476239 5:18395136-18395158 CTTGGCTACTGATTGTTGAAAGG + Intergenic
990827257 5:59914843-59914865 CTTGGTTATAATTTACTGATAGG + Intronic
990994285 5:61715816-61715838 CTTGGGTACAGTCTCCTGACTGG + Intronic
993982200 5:94556704-94556726 CATGTTTATAGTCTGCTGAAAGG - Intronic
995767324 5:115632729-115632751 CTTGGTAGCAGTTTGGTGATGGG + Intronic
995768936 5:115648933-115648955 CTTGGTAAAAGTTTTTTGAAGGG - Intergenic
996624907 5:125558961-125558983 GTTGTGTACAGTTTTCTGAATGG - Intergenic
997375882 5:133397080-133397102 CTTGGTGAGTGATTGCTGAAAGG + Intronic
997464350 5:134077402-134077424 CTCAGTAAGAGTTTGCTGAATGG - Intergenic
998290409 5:140909103-140909125 CTTGATGACATTTTGCTGATTGG - Intronic
998620740 5:143791754-143791776 CATGGTTACATTTTGCTTTATGG - Intergenic
999831203 5:155321998-155322020 CTAGGTAAAGGTTTGCTGAAGGG - Intergenic
1001994686 5:176146886-176146908 CATGGTGACAGATTGTTGAAAGG - Intergenic
1003282605 6:4706973-4706995 CTTGGTTACAGTGTTCAGGATGG + Intronic
1004608930 6:17220309-17220331 CTTGCTTTCACTTTGCTGTATGG - Intergenic
1010261305 6:73820238-73820260 CTTAGTTCCATTTTGCTGAATGG - Intronic
1011176836 6:84571838-84571860 CTTGGATACAGTATGCTTTAAGG + Intergenic
1011251089 6:85372786-85372808 CTTAGTTTCAGTTTGGTGACTGG - Intergenic
1013904262 6:115197247-115197269 CTTAATTAATGTTTGCTGAAAGG - Intergenic
1013921732 6:115413843-115413865 CTTGATTACAGTTTTCACAAAGG - Intergenic
1014535165 6:122605969-122605991 CTTGGCTACAGTGGACTGAATGG + Intronic
1015471085 6:133607210-133607232 CTTGATTCCAGTTTTCTTAAGGG - Intergenic
1015565608 6:134567491-134567513 ATTTGTGTCAGTTTGCTGAATGG - Intergenic
1016210313 6:141524274-141524296 CTTTGTTACAGTAGCCTGAATGG + Intergenic
1018449356 6:163892623-163892645 CTTGGTCAAGGTTTGCTGAATGG + Intergenic
1018594768 6:165467071-165467093 CTGGATTACACTTTGCTGTAAGG - Intronic
1019038900 6:169086609-169086631 CTTGCTTTCACTTTGCTGTATGG + Intergenic
1020353839 7:7255319-7255341 CCTGGTGAAAGTTTGTTGAATGG - Intergenic
1020864475 7:13540217-13540239 TATGGTTTCTGTTTGCTGAATGG - Intergenic
1021877428 7:25061824-25061846 CTTGGGTACAGTTTCCTGCCAGG - Intergenic
1023348335 7:39294167-39294189 CATGGTTTCAGGTTTCTGAAGGG - Intronic
1024045942 7:45585776-45585798 CTTGGCTTCAGTTTGTTCAAGGG + Intronic
1025073561 7:55922925-55922947 AGTGTTTACAGTTTGCTGCACGG - Intronic
1027841208 7:83314428-83314450 CTTGGTAGCAGTTTGCAGAAGGG + Intergenic
1030486156 7:110170572-110170594 CTTGGTAAGTGTTTGCTAAATGG + Intergenic
1031867180 7:127050334-127050356 CATGGTTCCAGTCTTCTGAATGG - Intronic
1032374054 7:131392109-131392131 ATTGGTTACAGATGGCTCAAAGG + Intronic
1039604162 8:38867114-38867136 CTTGCTTCCACTTTGCTGTATGG + Intergenic
1040460212 8:47640297-47640319 GTTGGGTAGAGTTTGCTGACCGG + Intronic
1042242697 8:66680646-66680668 CCCGGTTTCAGTTTCCTGAAAGG + Exonic
1043501831 8:80866153-80866175 CTTGGTTACAGTTGTTTTAAAGG + Intronic
1046340670 8:112850455-112850477 CATGGTTACAAATTGATGAATGG + Intronic
1048908196 8:139108965-139108987 CTGGGAAACAGTATGCTGAAAGG - Intergenic
1051403882 9:16713270-16713292 ATTGGTCACAATTTGTTGAAAGG - Intronic
1053478694 9:38400414-38400436 CTTGGTGAGAGTTTGCTAAGTGG - Intergenic
1053710633 9:40803530-40803552 CTTAGTGAGAGTTTGCTGAGTGG - Intergenic
1054420544 9:64924308-64924330 CTTAGTGAGAGTTTGCTGAGTGG - Intergenic
1055460619 9:76516710-76516732 CTTGGTAACATTTCGCTGAGAGG + Intergenic
1056677324 9:88686518-88686540 CTTGCTTTCACTTTGCTGTATGG + Intergenic
1186545781 X:10447958-10447980 ATTGGTTCTAGTTTGATGAAGGG - Exonic
1189428412 X:40924189-40924211 CCTGGTTACCCTTTTCTGAATGG - Intergenic
1194693940 X:97021816-97021838 CTTAGTCACTGTTTCCTGAATGG - Intronic
1195135120 X:101898530-101898552 CATGGATACATCTTGCTGAAAGG - Intronic
1198667761 X:139043830-139043852 CTTGGAAACATTTTGCTAAATGG + Intronic
1200213272 X:154356322-154356344 CCTGGCTACTGTTTGCAGAATGG - Intronic