ID: 1096098773

View in Genome Browser
Species Human (GRCh38)
Location 12:48956611-48956633
Sequence CTTCCTCCCCAGGCGGAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 344}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096098773_1096098779 -1 Left 1096098773 12:48956611-48956633 CCCCGCTCCGCCTGGGGAGGAAG 0: 1
1: 0
2: 2
3: 23
4: 344
Right 1096098779 12:48956633-48956655 GGCCCCACCTCTCTTCTCCCAGG 0: 1
1: 0
2: 12
3: 39
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096098773 Original CRISPR CTTCCTCCCCAGGCGGAGCG GGG (reversed) Intronic
900165765 1:1243753-1243775 CTTTATGCCCAGACGGAGCGTGG - Intronic
900210641 1:1454240-1454262 CTTCTCCCTCAGGCGGAGAGAGG + Intronic
900216514 1:1484911-1484933 CTTCTCCCTCAGGCGGAGAGAGG + Intronic
900722633 1:4187296-4187318 CCTCCTCCCCAGGCCAAGCTAGG - Intergenic
901323948 1:8356071-8356093 CTTCCCCTCCAGGAGGGGCGGGG - Intronic
902263927 1:15247579-15247601 CTTCCTCCGCGGGCGGGGTGGGG - Intronic
903054584 1:20626722-20626744 CTTCCTTCCCAGCAGGAGTGAGG - Intergenic
903754694 1:25652623-25652645 CTTCCTCCTGAAGCAGAGCGTGG + Intronic
909551105 1:76898837-76898859 CTTCCTCGCCAGGCCGAGCTAGG - Intronic
909788347 1:79642782-79642804 CCTCCTCACCAGGCAGAGCTAGG - Intergenic
909793062 1:79700373-79700395 CTTCCTCACCAGGCCAAGCTAGG - Intergenic
910049293 1:82956986-82957008 CCTCCTCCCCAGGCTGAGCTAGG + Intergenic
910182964 1:84505892-84505914 CGTCCTCTCCAGGGGAAGCGAGG + Intronic
912296393 1:108474631-108474653 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
913971385 1:143420715-143420737 CTGCCTCCCCACGTGGAACGAGG - Intergenic
914065762 1:144246328-144246350 CTGCCTCCCCACGTGGAACGAGG - Intergenic
914113389 1:144720026-144720048 CTGCCTCCCCACGTGGAACGAGG + Intergenic
915327053 1:155086045-155086067 CTTGCTCCCCAGCCGTAGCAAGG + Intronic
916231832 1:162548461-162548483 GTTCCTCCCCAGGGAGAGAGAGG - Intergenic
916485630 1:165256015-165256037 CTTCCTCCGCAGCATGAGCGTGG + Intronic
918296401 1:183161225-183161247 CTTTCTCCCCTGGCTGGGCGCGG - Intergenic
921520047 1:216147227-216147249 GTTCCTCGCCAGGCCGAGCTAGG + Intronic
922906315 1:229176100-229176122 CCTCCTCACCAGGCCGAGCTAGG + Intergenic
922934738 1:229414064-229414086 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
923075121 1:230602909-230602931 CCTCCTCACCAGGCCGAGCTAGG + Intergenic
923770822 1:236936285-236936307 CCTCCTCACCAGGCTGAGCTAGG - Intergenic
924180572 1:241435639-241435661 CCTCCTCGCCAGGCCGAGCCAGG + Intergenic
1065590438 10:27256956-27256978 CTTCAGTCCCAGGCGGTGCGCGG - Intergenic
1066563252 10:36692541-36692563 CTTCCTCCGGAGCCGGAGCTGGG - Intergenic
1068592426 10:58865049-58865071 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1069982295 10:72260929-72260951 CTTCCTCCCGAGGGTGGGCGGGG + Intergenic
1073595213 10:104792808-104792830 CTTCCTCCCCAGGAAGACTGTGG + Intronic
1073797821 10:107007210-107007232 CCTCCTCCCAAGGCAGAGAGGGG + Intronic
1076768917 10:132652355-132652377 CTGCAGCCCCAGGAGGAGCGGGG + Intronic
1076819566 10:132931681-132931703 CTTCCTCCCCACACAGAGCCTGG + Intronic
1076880784 10:133238179-133238201 CTTCCTTCCCAGGTGGAGATGGG + Intronic
1076903767 10:133352323-133352345 GGTCCTCCTCAGGCGGAGGGTGG - Exonic
1077111790 11:865292-865314 CTTCCTCCCCAGGCTGGGGGAGG - Intronic
1077371874 11:2186113-2186135 CTCCCTGCCCAGGCGGACAGTGG - Intergenic
1079447380 11:20569469-20569491 CCTCCTCGCCAGGCCGAGCTAGG + Intergenic
1080227273 11:29975062-29975084 CCTCCTCCCCAGGCAGAACTAGG + Intergenic
1083843514 11:65317478-65317500 CTCCCTCCCCAGGCCCAGCCAGG - Intronic
1083933967 11:65860761-65860783 CTTCCGGCCCAGGCGGACCGGGG - Exonic
1083993776 11:66262111-66262133 CTTCCTTCCCAGGAGGAGAAGGG + Exonic
1084355466 11:68635391-68635413 CTCCCTCGCCAGGCCGAGCTAGG + Intergenic
1084591810 11:70094676-70094698 CTTCCTCCCCTGGGGGAGAACGG - Intronic
1086125390 11:83344154-83344176 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1089347151 11:117797597-117797619 CACCCTCCCCAGGAGGAGCATGG + Intronic
1089472172 11:118730195-118730217 GCTCCTCCCCAGGCTGAGCTAGG - Intergenic
1089479013 11:118790740-118790762 CTTCCTCCCCAGGCCCGGCCAGG + Intronic
1089867141 11:121642006-121642028 CCTCCTCGCCAGGCCGAGCCAGG - Intergenic
1090850684 11:130568395-130568417 CCTCCTCGCCAGGCCGAGCCAGG - Intergenic
1090972588 11:131655965-131655987 ATTCCTTCCCAGGCTGAGGGAGG - Intronic
1091448539 12:558667-558689 CTCCCTCCCCAGTCTGAGCAGGG - Intronic
1092416259 12:8292598-8292620 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1092592835 12:9967126-9967148 CCTCCTCACCAGGCCGAGCTAGG - Intronic
1092789626 12:12060078-12060100 CCTCCTCGCCAGGCCGAGCTAGG + Intronic
1092883819 12:12908608-12908630 CTTCCTCCCCCGGACGAGCTTGG - Exonic
1093024233 12:14232223-14232245 CCTCCTCCCCAGGCTGAGCCAGG + Intergenic
1093268093 12:17025730-17025752 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1093322068 12:17724332-17724354 CTTCCTCGCCAGGCTGAGCTAGG - Intergenic
1093950985 12:25164806-25164828 CCTCCTCACCAGGCCGAGCTAGG + Intronic
1094400578 12:30057629-30057651 CCTCCTCACCAGGCCGAGCTAGG + Intergenic
1094523601 12:31217923-31217945 CTGCCACCCCAAGAGGAGCGTGG - Intergenic
1094825675 12:34267307-34267329 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
1095440832 12:42237859-42237881 CTTCCCCCTCAGCCGGAGCGCGG - Intronic
1095637571 12:44451450-44451472 CCTCCTCTCCAGGCCGAGCTAGG + Intergenic
1096098773 12:48956611-48956633 CTTCCTCCCCAGGCGGAGCGGGG - Intronic
1096459900 12:51816319-51816341 CTTCCTACCCAGGAGGGGAGGGG - Intergenic
1097277279 12:57822094-57822116 CTCCCACCCCAGGAGGAGGGAGG + Exonic
1097417134 12:59327246-59327268 GTTCCTCGCCAGGCCGAGCTAGG - Intergenic
1097542280 12:60956042-60956064 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1100940211 12:99716840-99716862 CCTCCTCGCCAGGCCGAGCTAGG + Intronic
1101278478 12:103226710-103226732 GTTCCTCACCAGGCTGAGCTAGG - Intergenic
1103518094 12:121520527-121520549 CTTCCTCCCCAGTCAGATCTGGG + Intronic
1107621191 13:42232274-42232296 CTTCCTCACCTGGAGGATCGGGG + Intronic
1107683226 13:42871445-42871467 GTTCCTCGCCAGGCCGAGCTAGG - Intergenic
1108408531 13:50126247-50126269 CCTCCTCCGCAGGTGCAGCGGGG + Intronic
1108512903 13:51171532-51171554 CTTCCTCCCCAGGCTGCTCCTGG + Intergenic
1109716836 13:66230421-66230443 CTTCCTCCCCAGGCTGCTCCTGG - Intergenic
1110626371 13:77660160-77660182 CTCACTTCCCAGGCGGTGCGGGG + Intergenic
1110845254 13:80185323-80185345 CCTCCTCGCCAGGCCGAGCCAGG + Intergenic
1111458926 13:88516855-88516877 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1112236744 13:97643987-97644009 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
1112889407 13:104212118-104212140 CCTCCTCGCCAGGCTGAGCTGGG - Intergenic
1113426396 13:110211912-110211934 CTGTCTCCCCAGGGGGAGAGAGG - Exonic
1116573374 14:46545607-46545629 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
1116702491 14:48259441-48259463 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1116952832 14:50894851-50894873 CCTCCTCGCCAGGCCGAGCTAGG + Intronic
1117958005 14:61137490-61137512 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1119374726 14:74180546-74180568 CCTCCTCCCTAGGCTGGGCGCGG - Intronic
1120539646 14:85737031-85737053 CCTCCTCTCCAGGCTGAGCTAGG - Intergenic
1120618169 14:86732989-86733011 CCTCCTCACCAGGCCGAGCTAGG + Intergenic
1122789082 14:104176841-104176863 CTTCCTCCCGAGGCCCAGTGGGG + Exonic
1122791699 14:104186541-104186563 CTGCCTCCAGAGGCGGAGCCCGG - Intergenic
1202906011 14_GL000194v1_random:72880-72902 CTCCCTTCCGAGGAGGAGCGGGG + Intergenic
1123469385 15:20538846-20538868 CTTCTTCCCCAGGCTGGGAGTGG + Intronic
1123472599 15:20566227-20566249 CTTCTTCCCCAGGCTGGGAGTGG - Intergenic
1123645404 15:22434126-22434148 CTTCTTCCCCAGGCTGGGAGTGG + Intergenic
1123648677 15:22461853-22461875 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1123729662 15:23133832-23133854 CTTCTTCCCCAGGCTGGGAGTGG + Intronic
1123732904 15:23161218-23161240 CTTCTTCCCCAGGCTGGGAGTGG - Intergenic
1123747829 15:23331314-23331336 CTTCTTCCCCAGGCTGGGAGTGG + Intergenic
1123751037 15:23358595-23358617 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1124280197 15:28355166-28355188 CTTCTTCCCCAGGCTGGGAGTGG + Intergenic
1124283410 15:28382513-28382535 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1124299288 15:28529100-28529122 CTTCTTCCCCAGGCTGGGAGTGG + Intronic
1124349548 15:28944966-28944988 CTGCCTCCCTAGGCAAAGCGGGG - Intronic
1124482003 15:30087077-30087099 CTTCATCCCCAGGCTGGGAGTGG - Intronic
1124488461 15:30139177-30139199 CTTCATCCCCAGGCTGGGAGTGG - Intronic
1124521588 15:30410126-30410148 CTTCTTCCCCAGGCTGGGAGTGG + Intronic
1124537073 15:30556093-30556115 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1124543548 15:30608149-30608171 CTTCATCCCCAGGCTGGGAGTGG - Intronic
1124755068 15:32399145-32399167 CTTCATCCCCAGGCTGGGAGTGG + Intronic
1124777055 15:32597570-32597592 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1125213311 15:37240268-37240290 CCTCCTCACCAGGCCGAGCTAGG - Intergenic
1126778740 15:52120402-52120424 CTTCCTGCCCATGCGGGGAGTGG + Exonic
1126843665 15:52740268-52740290 GCTCCTCGCCAGGCGGAGCTAGG + Intergenic
1126912487 15:53430866-53430888 CTTCCTCGCCAGGCCAAGCTAGG - Intergenic
1127588271 15:60398025-60398047 CATCCTCCCTAGGCGAGGCGAGG + Intronic
1128520046 15:68369274-68369296 CTTCCTTCCCAGGCTGGTCGTGG - Exonic
1129037501 15:72659612-72659634 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1129212386 15:74077613-74077635 CTTCTTCCCCAGGCTGGGAGTGG + Intronic
1129398012 15:75263466-75263488 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1129401623 15:75287747-75287769 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1129475211 15:75780454-75780476 CTTCTTCCCCAGGCTGGGAGAGG - Intergenic
1129729519 15:77921931-77921953 CTTCTTCCCCAGGCTGGGAGTGG + Intergenic
1129838998 15:78732039-78732061 CTTCTTCCCCAGGCTGGGAGTGG - Intergenic
1132051452 15:98610965-98610987 ATGTCTCCCCAGGCTGAGCGTGG - Intergenic
1132262930 15:100441937-100441959 CCTCCTCACCAGGCTGAGCTAGG + Intronic
1132875689 16:2135921-2135943 CCTCCTCCCCGCGCGGCGCGGGG + Intergenic
1133220529 16:4317416-4317438 CTTCCTCCCCAGCCGCAGGCTGG - Intronic
1133765820 16:8837044-8837066 CCTCCTCGCCAGGCTGAGCTAGG - Intronic
1133766806 16:8843850-8843872 CCTCCTCGCCAGGCCGAGCTAGG - Intronic
1134014721 16:10879940-10879962 CTCCCTCCCCAGCCGCAGCCTGG + Intronic
1136455120 16:30376023-30376045 CTTCCACCCCAAGCAGAGAGGGG - Intronic
1137926638 16:52547104-52547126 CCTCCTCCCCGGGCGGACTGAGG + Intronic
1138447905 16:57076315-57076337 TTTCCTACCCAGGCAGAGCAAGG + Intronic
1138804862 16:60080514-60080536 GCTCCTCCCCAGGCCGAGCTAGG + Intergenic
1139943134 16:70620493-70620515 CCTCCTCGCCAGGCTGAGCTAGG - Intronic
1140209950 16:72961950-72961972 CTTCCTCGCAAGGCTGAGCCGGG + Intronic
1141075617 16:81004408-81004430 CTTCCTCCCCAGGCAGTCCCTGG - Intronic
1142606454 17:1084063-1084085 CTCCCTCCCCACGTGCAGCGTGG + Intronic
1142776257 17:2141731-2141753 GTTCCTCCTCAGGCTGAGTGAGG - Intronic
1143119346 17:4597378-4597400 CTTCTTCCCCAGGTGGGGCATGG + Intronic
1143446870 17:7014950-7014972 CTTCCGCCCCGGGCGGGGGGCGG + Intronic
1147159122 17:38560415-38560437 CTTCCTCCCCAGGGAGCGCATGG - Exonic
1147210655 17:38870742-38870764 CTTCCTGGCCTGGCGGGGCGGGG + Intronic
1147232026 17:39026585-39026607 CTTCCTGCACAGGCCGGGCGCGG - Intergenic
1148167001 17:45490643-45490665 CTAACTCACCAAGCGGAGCGAGG + Exonic
1148678944 17:49461997-49462019 CTTCCTCCCCAGGTGGATCAGGG + Intronic
1150398178 17:64837047-64837069 CTAACTCACCAAGCGGAGCGAGG + Intergenic
1150860580 17:68796652-68796674 CCTCCTCACCAGGCCGAGCCAGG - Intergenic
1151839844 17:76609983-76610005 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1151932282 17:77240197-77240219 ATTCCTCACCAGGCCGGGCGCGG - Intergenic
1152148055 17:78581063-78581085 CTACCTCCCCAGGGGGAAGGAGG - Intergenic
1152655575 17:81517785-81517807 CTTCCTCCCCAGAGGCAGCGAGG + Intronic
1152926230 17:83089026-83089048 CTTCCTCACCAGGAAGAGGGAGG + Intronic
1153619465 18:6963377-6963399 CTTCCTGCCAAGACGGAGCCAGG - Intronic
1156237268 18:35217421-35217443 CCTCCTCACCAGGCCGAGCTAGG + Intergenic
1157544778 18:48539817-48539839 CTCCCTACCTCGGCGGAGCGCGG - Exonic
1159886672 18:73914246-73914268 CTGCCTCCCCATGGGGAGCCTGG + Intergenic
1160184924 18:76668471-76668493 CCTCCTCCCCGAGCCGAGCGTGG + Intergenic
1160894630 19:1396723-1396745 CTCCCGCCCCAGGAGGGGCGTGG - Intergenic
1160895718 19:1401056-1401078 CTTCCTCTCCAGGGGGAGTGAGG - Intronic
1160960690 19:1719311-1719333 ATTCTTCCCCAGGCCGGGCGCGG + Intergenic
1160968626 19:1757658-1757680 CTTACGCCCCAGGCGGAGTCCGG - Intronic
1162831266 19:13286243-13286265 CTTCCTTCCCAAGGGGAGCCAGG - Intronic
1163011445 19:14429084-14429106 CTGCCTCCCCAGATGGAGCTGGG - Intergenic
1163239436 19:16051161-16051183 CTTCCGCCTCAGGAGGAGCTGGG - Intergenic
1163535038 19:17872177-17872199 TTCCCACCCCAGACGGAGCGGGG + Exonic
1163699864 19:18781710-18781732 CATCCTGCCCAGGAGGAGCCCGG - Exonic
1164459313 19:28433918-28433940 CCTCCTCTCCAGGCTGAGCTAGG - Intergenic
1165128800 19:33619705-33619727 CATCCTTCCCAGGAGGATCGCGG + Intergenic
1165427553 19:35754381-35754403 CTGCCTCCCCAGGTGGAAGGAGG + Exonic
1165510394 19:36263511-36263533 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1166361856 19:42255772-42255794 CTTCCTCCCCAGCTGGACGGGGG - Intergenic
1167674573 19:50876460-50876482 CTTCCTCCCCAGGAATAGCCAGG + Exonic
1168051502 19:53832945-53832967 CCTCCTCGCCAGGCCGAGCTAGG + Intergenic
1168212205 19:54898957-54898979 CCTCCTCGCCAGGCCGAGCTGGG - Intergenic
1168228069 19:55010806-55010828 CCTCCTCCCCAGGCTGAGCTAGG - Intergenic
925709701 2:6726896-6726918 CTTCTTCCCCAGGCAGCACGAGG + Intergenic
926250293 2:11151922-11151944 TTCCATCCCCAGTCGGAGCGCGG - Intergenic
926464172 2:13168017-13168039 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
927740901 2:25568901-25568923 CTTTCACCCCAGGCGGTGGGAGG - Intronic
929004919 2:37385036-37385058 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
932295770 2:70622301-70622323 CCTCCTCGCCAGGCCGAGCTAGG + Intronic
932358901 2:71089072-71089094 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
932367733 2:71163712-71163734 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
933079193 2:77966790-77966812 CCTCCTCGCCAGGCTGAGCCAGG + Intergenic
933179849 2:79215873-79215895 CTTCCTCGCAAGGCCGAGCTAGG - Intronic
933666706 2:84970817-84970839 CTTCCTCCCTACGCGCGGCGCGG + Intergenic
934176079 2:89581648-89581670 CTGCCTCCCCATGTGGAACGAGG - Intergenic
934286389 2:91656010-91656032 CTGCCTCCCCATGTGGAACGAGG - Intergenic
936794381 2:116188293-116188315 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
937150486 2:119682747-119682769 CAGCCTCCCCAGGCACAGCGTGG + Intronic
937805952 2:126145943-126145965 CTGCCACCCCAGGCTGAGCATGG + Intergenic
937966538 2:127515858-127515880 CTTCCTTCCCAGGAAGAGCAGGG + Intronic
939307321 2:140427799-140427821 CCTCCTCGCCAGGCCGAGCTAGG + Intronic
941353303 2:164460796-164460818 CCTCCTCCACAGGCCGAGCTAGG + Intergenic
942097000 2:172543393-172543415 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
942730376 2:179055804-179055826 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
943461280 2:188173259-188173281 CCTCCTCCCCAGGGCGAGCTAGG - Intergenic
945319624 2:208406723-208406745 CTCCCGCCCCAGGCGGATCCGGG - Intronic
945361560 2:208900902-208900924 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
945723368 2:213446769-213446791 CTTCCTCTCCTGGTTGAGCGGGG - Intronic
948824587 2:240568228-240568250 CTTCCTCCCCGGGCGGCGCCCGG - Intronic
1170325569 20:15151889-15151911 CCTCCTCGCCAGGCAGAGCTAGG - Intronic
1170756815 20:19212505-19212527 CCGCCGCCCCAGGCCGAGCGCGG + Intergenic
1171891813 20:30724339-30724361 CTCCCTTCCGAGGAGGAGCGGGG - Intergenic
1172515130 20:35528134-35528156 CTTCCTCCCCAGGTGCAACCAGG - Intronic
1174079687 20:47962146-47962168 CTTCATCCCCAGGCACAGGGAGG + Intergenic
1175916419 20:62428108-62428130 CTGCTTCCCCAGGCAGGGCGGGG - Intergenic
1176181652 20:63752341-63752363 CTCCCTCCCGAGGCAGGGCGGGG + Intronic
1176625366 21:9087636-9087658 CTCCCTTCCGAGGAGGAGCGGGG + Intergenic
1177102596 21:16915642-16915664 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
1177196752 21:17911459-17911481 CTCCCTTCCCAGGTGGAGCCTGG + Intronic
1178536046 21:33411284-33411306 CTTCCACCCCAAGCGACGCGTGG - Intronic
1178743719 21:35227115-35227137 GTTCTTCCTCAGGCGGAGAGGGG - Intronic
1179015373 21:37591074-37591096 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1179387471 21:40956632-40956654 GCTCCTCTCCAGGCGGAGCTAGG + Intergenic
1179994522 21:44967817-44967839 CGTCCTCCCCAGGAGGGACGGGG + Intronic
1182390813 22:29994038-29994060 CTTCCTGCCCAGGCTGATCCAGG + Intronic
1183465817 22:37979958-37979980 CTCCCTCCCCAGGCTGGGCGGGG + Intronic
1185078505 22:48696176-48696198 CTTCCTCCCCAGCCTCAGTGTGG - Intronic
1185094850 22:48800612-48800634 GTTCCAACCCAGGTGGAGCGAGG + Intronic
950456066 3:13093441-13093463 CTTCCTCCACAGGAGGAGCTGGG + Intergenic
952967492 3:38630333-38630355 CTTCCACCCCATCCGGAGAGCGG - Exonic
954626356 3:52024002-52024024 CTTCCTCCCCTGGGAGAGCGTGG + Intergenic
954808636 3:53234567-53234589 CCTCCTCCCCAGGCTGGGCGGGG + Intronic
956549073 3:70438919-70438941 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
960282964 3:115797532-115797554 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
961555610 3:127694930-127694952 CTTCCCCCCAAGGTGGAGGGGGG - Intronic
961730498 3:128961395-128961417 CCTCCTCACCAGGCCGAGCTAGG + Intronic
962205473 3:133430806-133430828 CCTCCTCACCAGGCCGAGCTAGG + Intronic
963269132 3:143268441-143268463 CTTCCTCCTCAGGCCGGGCACGG + Intronic
964300335 3:155279238-155279260 CCTCCTCACCAGGCTGAGCTAGG - Intergenic
965336240 3:167432869-167432891 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
965624969 3:170676572-170676594 CCTCCTCCCCAGGCCAAGCTAGG - Intronic
966232933 3:177669875-177669897 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
966398534 3:179524972-179524994 GTTCCTCGCCAGGCCGAGCCAGG - Intergenic
967904175 3:194487032-194487054 CTTCATCCCCGCGCGGAGGGCGG + Intronic
968057219 3:195701506-195701528 GTTCCTCCCCAGGAGTAGGGAGG + Intergenic
968649295 4:1754059-1754081 GCTCCTCCCCAGGGGGAGCCTGG + Intergenic
969003898 4:4004271-4004293 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
969204532 4:5633483-5633505 CTTCCTCCCCTAGCTGAGCATGG - Intronic
969604863 4:8197431-8197453 CTTCCTCCTCAGACGCAGCCGGG + Intronic
969810029 4:9640553-9640575 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
970256509 4:14174559-14174581 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
970542738 4:17095911-17095933 CTTACTCCACAGGGGGAGCCTGG - Intergenic
971200046 4:24502689-24502711 CTTCCTCCCCAGCCCAAGCTAGG + Intergenic
979895249 4:126149169-126149191 CCTCCTCACCAGGCCGAGCTAGG - Intergenic
980112015 4:128644878-128644900 CCTCCTCGCCAGGTGGAGCTAGG - Intergenic
980284864 4:130769012-130769034 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
980472528 4:133267751-133267773 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
980611862 4:135171324-135171346 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
980903852 4:138929551-138929573 GCTCCTCGCCAGGCGGAGCTAGG + Intergenic
981482810 4:145255587-145255609 GCTCCTCGCCAGGCTGAGCGAGG - Intergenic
982180564 4:152745385-152745407 CCTCCTCGCCAGGCCGAGCTAGG - Intronic
982414283 4:155112495-155112517 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
982535357 4:156601961-156601983 CCTCCTCGCCAGGCCGAGCTAGG + Intergenic
984099136 4:175465466-175465488 CTTCCTCGCCAGGCCGAACTAGG - Intergenic
984437174 4:179722095-179722117 CTTCCTCCCCAGGCCGAGCTAGG + Intergenic
985435639 4:189927499-189927521 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
985546147 5:510121-510143 CTTGGGCCCCTGGCGGAGCGCGG + Intronic
985881153 5:2640209-2640231 CTTCTTCCCCAGGCGGCAGGAGG + Intergenic
986388793 5:7265264-7265286 CCTCCTCGCCAGGCCGAGCTAGG + Intergenic
986733022 5:10649195-10649217 CTTCCCTCCCAGGCAGAGCCTGG - Intronic
987103984 5:14618741-14618763 CTTCCTGCCCTGGCGGTGTGTGG - Intergenic
991396253 5:66208203-66208225 CCTCCTCCCCCAGCTGAGCGAGG - Intergenic
992960744 5:81954926-81954948 CCTCCTCACCAGGCCGAGCTAGG + Intergenic
996509818 5:124305438-124305460 CCTCCTCGCCAGGCCGAGCTAGG + Intergenic
997652758 5:135534877-135534899 CCCCCTCTCCAGGCGGAGGGAGG - Exonic
997712185 5:136015197-136015219 CTCCCTCCCCAGGCAGAGACAGG - Intergenic
998392297 5:141795187-141795209 CTTCCTCCCTAGGCTCAGAGAGG + Intergenic
998424177 5:142012944-142012966 CTTCCTCGCGGGCCGGAGCGCGG - Intronic
998693792 5:144615412-144615434 CCTCCTCACCAGGCTGAGCTAGG - Intergenic
998850266 5:146344964-146344986 CCTCCTCCCGAGGAGGGGCGGGG + Intergenic
1002662775 5:180802846-180802868 CTTCCCCGGCAGGCGGGGCGGGG + Intronic
1003552342 6:7109507-7109529 CTTTCTCTCCGGGCGGGGCGGGG + Intronic
1004106174 6:12669047-12669069 CCTCCTCCCCAGGCCGAGCTAGG + Intergenic
1005650327 6:27879568-27879590 CTCCCACCCCAGGAGGAGGGAGG + Intergenic
1005826034 6:29632485-29632507 CTTGGTCCCCAGGCTGAGCCCGG - Intronic
1006463577 6:34177780-34177802 CTTCCTCTCCTGGCGGTGGGGGG - Intergenic
1007737809 6:43992793-43992815 CTTCCTCCCCACTCAGAGGGAGG + Intergenic
1009682781 6:66920737-66920759 CTTCCTCCCCAGTGGAAGGGTGG + Intergenic
1010586785 6:77664585-77664607 CCTCCTCACCAGGCCGAGCTAGG - Intergenic
1010841400 6:80651869-80651891 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1010894623 6:81349145-81349167 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1013163603 6:107569836-107569858 TTTCCTTCCCAGGTGGGGCGAGG - Intronic
1013783991 6:113758958-113758980 CTTCCTCTCCAGACAGAGCAAGG - Intergenic
1014614759 6:123586325-123586347 CCTCCTCGCCAGGCCGAGCTAGG - Intronic
1014718807 6:124893714-124893736 CCTCCTCGCCAGGCCGAGCTAGG + Intergenic
1015271286 6:131340552-131340574 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
1015769238 6:136752338-136752360 CTTCCTCCTCAGGAAGAGCTGGG - Intronic
1016204446 6:141454486-141454508 CCTCCTCCCCAGGCCGAGCTAGG + Intergenic
1016535842 6:145107182-145107204 CCTCCTCACCAGGCCGAGCTAGG - Intergenic
1017389407 6:153923163-153923185 CCTCCTCGCCAGGCCGAGCTAGG + Intergenic
1017719779 6:157236305-157236327 CGGCCCACCCAGGCGGAGCGCGG + Intergenic
1019273106 7:161540-161562 CTTCCGTCCCAGCCGGGGCGGGG + Intergenic
1019440678 7:1044703-1044725 CTCCCTCCCCAGGCGGAGACTGG - Intronic
1019927856 7:4205095-4205117 GCTCCTCCCCAGGGGGAGCGAGG + Intronic
1022427722 7:30284724-30284746 CCTCCTTCGCAGGGGGAGCGAGG + Exonic
1024599700 7:50969845-50969867 TTTCCTCCCTAGGGGGAACGGGG + Intergenic
1024697537 7:51871695-51871717 GTTCCTCGCCAGGCCGAGCTAGG + Intergenic
1028402805 7:90442599-90442621 CTTCCTCCTCAGGAGGAGTTGGG + Intronic
1029147781 7:98458871-98458893 CTTGCTCCCCAGGTGGGCCGAGG - Intergenic
1029222819 7:99003667-99003689 CTTCCTCTCCACGCGGTGGGAGG + Intronic
1029712815 7:102308803-102308825 CTTCCTCCCCAGGTAGAGAATGG + Exonic
1031004583 7:116457161-116457183 CCTCCTCGCCAGGCCGAGCTAGG + Intronic
1031924076 7:127621243-127621265 CTTCCACCCCATGCGAAGTGGGG - Intergenic
1033223822 7:139545487-139545509 CTTCCTCCCCAGGCAGCTCAAGG - Intergenic
1034487218 7:151373578-151373600 CTTGCTCCCCAGGCTGTGGGGGG + Intronic
1035171591 7:157020370-157020392 CCTCCTCCCCACGCAGACCGCGG + Intergenic
1035880754 8:3242275-3242297 CTTCCTCCCCAGGCCGAGCTAGG - Intronic
1036071011 8:5440696-5440718 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1036664592 8:10730450-10730472 CTGCCCCGCCAGGCGAAGCGAGG - Intronic
1038414104 8:27380714-27380736 CTCCCTCCCAGGGCGGAGCTCGG - Intronic
1038487631 8:27948240-27948262 CCTCCTCCCCAGGGTGAGGGCGG + Intronic
1040567698 8:48582227-48582249 CTGCATCCCCAGGCTGAGAGGGG - Intergenic
1040988960 8:53328377-53328399 CTTCCTCCCCAGGCCCACTGTGG - Intergenic
1043353758 8:79390138-79390160 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1043717985 8:83509176-83509198 CCTCCTCACCAGGCTGAGCTAGG - Intergenic
1043837638 8:85064607-85064629 CCTCCTCTCCAGGCCGAGCCAGG + Intergenic
1044148598 8:88746248-88746270 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1044921900 8:97176758-97176780 CCTCCTCGCCAGGCCGAGCTAGG + Intergenic
1044925073 8:97202602-97202624 CCTCCTCGCCAGGCCGAGCTAGG + Intergenic
1045285698 8:100789417-100789439 CTTCCTCCCCAGGCAGTGGAGGG + Intergenic
1045328748 8:101137285-101137307 CTTCCTGCCCAGCTGGAGGGAGG + Intergenic
1045644698 8:104287621-104287643 CCTCCTCGCCAGGCCGAGCTAGG + Intergenic
1047699266 8:127433405-127433427 CCTCCTCGCCAGGCCGAGCTAGG + Intergenic
1048097527 8:131311850-131311872 CCTCCTCGCCAGGCCGAGCTAGG + Intergenic
1048135381 8:131742376-131742398 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
1049238889 8:141526548-141526570 GTTCCTCCCCAGGCGACGCCGGG - Intergenic
1049418511 8:142506339-142506361 CTTCCTGCCCAAGAGGAGTGGGG - Intronic
1049530062 8:143149560-143149582 CTTTCTTCTCAGGCGGAGCAGGG - Intergenic
1050258198 9:3815230-3815252 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1051849376 9:21489734-21489756 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1051953490 9:22662581-22662603 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1052162998 9:25289350-25289372 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
1052720730 9:32168587-32168609 CCTCCTCGCCAGGCTGAGCCAGG - Intergenic
1053057932 9:35005123-35005145 CCTCCTCACCAGGCAGAGCCAGG + Intergenic
1053906936 9:42852133-42852155 CTCCCTTCCGAGGAGGAGCGGGG + Intergenic
1054357001 9:64071358-64071380 CTCCCTTCCGAGGAGGAGCGGGG + Intergenic
1054368686 9:64369133-64369155 CTCCCTTCCGAGGAGGAGCGGGG + Intergenic
1054528033 9:66153374-66153396 CTCCCTTCCGAGGAGGAGCGGGG - Intergenic
1054807575 9:69408812-69408834 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1055347807 9:75355840-75355862 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1056044825 9:82704743-82704765 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1056684300 9:88746913-88746935 CTTCCTCCCCAGGCCACCCGGGG + Intergenic
1056817372 9:89811672-89811694 CTTCCTCTCCAGGTGCAGGGTGG + Intergenic
1058836294 9:108861138-108861160 CTTCCTCCCCAGGATGTGCTGGG - Intergenic
1060318555 9:122534646-122534668 CCTCCTCGCCAGGCCGAGCTAGG - Intergenic
1060737971 9:126078687-126078709 CCTCCTCACCAGGCCGAGCTAGG - Intergenic
1061064003 9:128266181-128266203 CTTCTTCCCCAGGCTGGGAGTGG + Intronic
1062372988 9:136249632-136249654 CTCACTGCCCAGGCGGAGCAGGG - Intergenic
1062544605 9:137055820-137055842 CTCCCTCCGCAGGCGAAGCTGGG - Intergenic
1062566472 9:137166009-137166031 CTCCCACCCCAGGCTGAGCGGGG + Intronic
1062627388 9:137449484-137449506 CTGCTTCCCTGGGCGGAGCGGGG + Exonic
1203748540 Un_GL000218v1:58097-58119 CTCCCTTCCGAGGAGGAGCGGGG + Intergenic
1203561180 Un_KI270744v1:59923-59945 CTCCCTTCCGAGGAGGAGCGGGG - Intergenic
1188419396 X:29976937-29976959 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
1188430938 X:30105004-30105026 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
1190100678 X:47520606-47520628 GATCCTCCCAAGGCGGGGCGTGG - Intergenic
1194308620 X:92277077-92277099 CCTCCTCGCCAGGCTGAGCTAGG - Intronic
1194660594 X:96625683-96625705 CTTCCTCACCAGGCCGAGCTAGG + Intergenic
1196017690 X:110956930-110956952 CTTCATCACCAGGCTGAGCTAGG - Intronic
1196221074 X:113112764-113112786 CCTCCTCGCCAGGCCGAGCCAGG - Intergenic
1196533622 X:116816495-116816517 CTTCCTCCCCAGGACGAGCTAGG - Intergenic
1197932990 X:131713717-131713739 CCTCCTCGCCAGGCCGAGCTAGG + Intergenic