ID: 1096102599

View in Genome Browser
Species Human (GRCh38)
Location 12:48978730-48978752
Sequence CTGCCAACAGCAGTGGCCGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 274}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096102593_1096102599 -2 Left 1096102593 12:48978709-48978731 CCGCTCTGCCCGCAGCCCTGGCT 0: 1
1: 0
2: 9
3: 67
4: 584
Right 1096102599 12:48978730-48978752 CTGCCAACAGCAGTGGCCGATGG 0: 1
1: 0
2: 2
3: 18
4: 274
1096102594_1096102599 -10 Left 1096102594 12:48978717-48978739 CCCGCAGCCCTGGCTGCCAACAG 0: 1
1: 0
2: 4
3: 51
4: 407
Right 1096102599 12:48978730-48978752 CTGCCAACAGCAGTGGCCGATGG 0: 1
1: 0
2: 2
3: 18
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096102599 Original CRISPR CTGCCAACAGCAGTGGCCGA TGG Exonic
900951365 1:5859872-5859894 CTGCCCACAGATGTGGCCGTGGG + Intergenic
901230918 1:7641348-7641370 CTGCCATCAGCAGGGCCTGAGGG + Intronic
902282111 1:15382240-15382262 CTCCCATTAGCAATGGCCGAGGG + Intronic
904590775 1:31614262-31614284 GGGCCAACAGCAGTGGCCTCTGG - Intergenic
907421413 1:54349931-54349953 CAGCCAACAGCAGAGGCTAAAGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910514015 1:88037574-88037596 GTGGCAGCAGCAGTGGCAGAAGG - Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
912653255 1:111460612-111460634 AAGCCAACATCAGTGGCAGATGG + Intronic
915527285 1:156483639-156483661 CTGAGGACAGCAGTGACCGAGGG - Intronic
915791305 1:158674574-158674596 CTGCCAACAGATGTGGCTGGTGG - Exonic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921287640 1:213623249-213623271 CTGTCAACAGCATTGACTGAAGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1067751102 10:48971814-48971836 CTGACAACAGCAGTTGGTGAAGG - Intronic
1067755237 10:49000134-49000156 CAGCCCACTGCAGTGGCAGAGGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1070498758 10:77050454-77050476 TTGCTAACAGCAGTGGCTGGTGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071771286 10:88731482-88731504 CTGCCAGCAGCAGCGCCTGAGGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1072903893 10:99433044-99433066 CTTCCAAAAGCAGGGGCAGAGGG + Intergenic
1073300618 10:102469066-102469088 CTGCCCACAGCTGTGGTCTATGG + Exonic
1074342041 10:112641570-112641592 CTCCCAACAGCAGTTGGCAAGGG + Intronic
1075790599 10:125081883-125081905 CAGCCAACAGCAGAGACAGAAGG - Intronic
1076024101 10:127098432-127098454 CTACCAGCAGCAGTGGCGGCAGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1078448817 11:11425130-11425152 CTCCCAACAACAGTGTCAGATGG - Intronic
1079453408 11:20617137-20617159 CTGCCAACAGAAGAGGCCACTGG - Intronic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1083637694 11:64129337-64129359 CTCCCAACAGCAGTCGGGGATGG - Intronic
1083718771 11:64593712-64593734 CTGACAGCTGCAGTGGCCTACGG + Exonic
1083920654 11:65780195-65780217 CCGCCAGCAGCAGTGGCCGACGG + Exonic
1084762809 11:71284687-71284709 CTGCCAAAAGCATTGGCCAGGGG - Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088445542 11:109923438-109923460 CGGCCAACATCAGTGGCCCTGGG + Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1091325111 11:134680321-134680343 CAGCAAACAGCAGTGGCTGCTGG - Intergenic
1091401807 12:185737-185759 CTGGCCACAGCAGGGGCAGATGG - Intergenic
1093156940 12:15697352-15697374 CTGCCAATAGCAGTGACAGCAGG + Intronic
1093731204 12:22567842-22567864 CTGCAAACAGCAGTGTCACATGG + Intergenic
1095532741 12:43208810-43208832 CTGCCAATGGCATTGGCCCATGG + Intergenic
1095808193 12:46344028-46344050 CTGCCAATAGCAGTTGCCTCTGG + Intergenic
1096102599 12:48978730-48978752 CTGCCAACAGCAGTGGCCGATGG + Exonic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096803243 12:54125778-54125800 CGGCCAACAGGAGTGGGCCAAGG + Intergenic
1098133882 12:67381019-67381041 CTGGCAACAGCACTAGCCAAAGG + Intergenic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1103135511 12:118503651-118503673 TTCCCAACACCAGTGCCCGAGGG + Intergenic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104821097 12:131678054-131678076 CCAGCAACAGCAGCGGCCGATGG - Intergenic
1106681238 13:32010438-32010460 CTCCCGAGAGCAGTGGCAGATGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1109351448 13:61187785-61187807 CTGCCAACCACAGTAGCCAAAGG - Intergenic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110185585 13:72671075-72671097 CTGCCAACAGGAGTGGAAAATGG + Intergenic
1111235757 13:85405723-85405745 CTTCCACCAGCAGCGGCAGAGGG + Intergenic
1111288714 13:86131955-86131977 CTCCCAACAGCAGTGGATAAGGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112730994 13:102362059-102362081 CTGCCAGCAGCAGTGGCCCCAGG - Intronic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1118234875 14:63993125-63993147 CTGCCAACATGAGTGGCCCTGGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1122070830 14:99204401-99204423 CTTCCATCTGCAGTGGCCAAAGG + Intronic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124192954 15:27596530-27596552 TTTCCACCAGCAGTGTCCGAAGG - Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132035847 15:98483674-98483696 CTCTCAACAGCAGTGTCTGAGGG - Intronic
1132533568 16:466308-466330 CTGGGAACAGCAGTGGCCCCGGG + Intronic
1134082058 16:11331748-11331770 CTTTCAACAGCACTGGCCAATGG - Intronic
1135295499 16:21276319-21276341 CTGCCAACAGCGGTTCCCTAGGG - Intronic
1136551691 16:30985481-30985503 CAGCCATCAGCAGGGGCAGACGG + Intronic
1137411779 16:48234737-48234759 CTGCCAACAGAAGTGGGACAGGG + Intronic
1139212261 16:65090985-65091007 ATGCCAGCAGCAGTTGCCTAGGG - Intronic
1143108719 17:4541973-4541995 CTGCCCACAGCAGTGCCCAGCGG - Intronic
1143730007 17:8876073-8876095 CTGCCAACAGCAGGACCCAATGG + Intergenic
1145940598 17:28741483-28741505 CATCCAACTGCACTGGCCGAGGG - Exonic
1147133145 17:38420442-38420464 CTGCCTAAAGCAGTGGCTGGGGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150136473 17:62698085-62698107 CTTCCCAAAGCAGTGGCGGAGGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1156385142 18:36597760-36597782 CAGACAACAGCAGTTGCCAAAGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1161155588 19:2730724-2730746 CTTCCAACAGCAGTGGGGTAAGG + Intronic
1163769097 19:19179942-19179964 CTGCCAACAGTCCTGGCCAAGGG + Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165320683 19:35083545-35083567 CTGCCAACAGCAGAGCCCTGTGG - Intergenic
1167151735 19:47713921-47713943 ATGCTATCAGCGGTGGCCGATGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925345538 2:3169580-3169602 CTGCCGCCAGCCCTGGCCGAGGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931762409 2:65430448-65430470 CTGGCAACAGCAGACGCCAAAGG + Intronic
931906652 2:66850135-66850157 CTGCAAACTGCAGTGGCCACTGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934527108 2:95058773-95058795 CAGCCAAAGGGAGTGGCCGAGGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936756529 2:115720142-115720164 CTCCCACCAGCAGTGCACGAGGG + Intronic
937245327 2:120488795-120488817 CTGCCAACAGCAGGTGCCAAGGG + Intergenic
937465748 2:122131676-122131698 CAGCCCACAGCAGTGGCAGTGGG + Intergenic
937862646 2:126723000-126723022 CAGCAGACAGCAGTGGCAGAGGG + Intergenic
938337299 2:130511308-130511330 CTGCCGGCAGCAATGGCCTATGG + Intergenic
938352539 2:130609427-130609449 CTGCCGGCAGCAATGGCCTATGG - Intergenic
938584085 2:132671389-132671411 CTGCCCCCAGAAGTGGCCGGGGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
946728741 2:222688278-222688300 CTGCTCACTGCAGTGGCCCATGG - Intronic
946782505 2:223205756-223205778 GTGCCAGCAGCAGTGGCAGTGGG - Intergenic
947263490 2:228251550-228251572 ATGCCAGCAGCAGTGGCAGTGGG + Intergenic
947856288 2:233326743-233326765 CTGCCTACAGCAGGGGCCAGAGG - Intronic
948555517 2:238807327-238807349 CTGCCATGAGCCGTGGCCTATGG - Intergenic
1169368921 20:5013501-5013523 ATGCCATCAGCATTGGACGATGG + Intergenic
1171400514 20:24870459-24870481 TTCCCAGCAGCAGTGGCCAAGGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171818331 20:29809105-29809127 CTCCCAACAGCAGTGTACGAGGG + Intergenic
1171854948 20:30335574-30335596 CGGCCAACAGGAGTGGGCAAAGG + Intergenic
1171898178 20:30830090-30830112 CTGCCAACACTACTGGCCCATGG - Intergenic
1171899472 20:30843898-30843920 CTCCCAACAGCAGTGTACAAGGG - Intergenic
1172383909 20:34519284-34519306 CTGCCAACAGAAGTTGCCACGGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173899618 20:46577752-46577774 CTGTCTACAGCAGTAGCTGAAGG + Intronic
1174295803 20:49544228-49544250 CAGCCATGAGCAGTGGCCAAGGG - Intronic
1174681060 20:52408853-52408875 TTGCCAAGAACAGTGGCCAAAGG - Intergenic
1174906425 20:54557013-54557035 CAGCCAACACCATTTGCCGATGG - Intronic
1175687412 20:61041614-61041636 CCTCCAACAGCAGTGGCAAATGG + Intergenic
1175723407 20:61300939-61300961 CTGCCAGCTGCAGGGGCCGGGGG - Intronic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178598057 21:33972742-33972764 GTGCCAGCAGCCCTGGCCGAAGG + Intergenic
1179523102 21:41958171-41958193 CTTCCCACAGCAGCTGCCGAGGG - Intergenic
1180321770 22:11328514-11328536 CTCCCAACAGCAGTGTACAAGGG + Intergenic
1180323639 22:11347780-11347802 CTGCCAACACTACTGGCCCATGG + Intergenic
1180333285 22:11552178-11552200 CTCCCAACAGCAGTGTACAAGGG - Intergenic
1180969231 22:19806422-19806444 CAGCCAGCAGCAGTGGCAGCAGG - Intronic
1181174137 22:21026522-21026544 CTCCCAGCAGCAGTGGCCGTGGG - Exonic
1182349637 22:29692092-29692114 GGGCGAGCAGCAGTGGCCGAAGG + Intronic
1183329537 22:37211987-37212009 CTGTGGACAGCCGTGGCCGAGGG - Exonic
1184100821 22:42341065-42341087 CTGCCAGGAGCAGAGGCCGGAGG + Intronic
1184370875 22:44081225-44081247 CTGCCAGCACCAGAGGCCAATGG + Intronic
1184480405 22:44743405-44743427 CTGCCAACCACCGTGGCAGAGGG - Intronic
1185026903 22:48419604-48419626 CTCCCAACAGCCGTGACCCAGGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950164166 3:10781000-10781022 CTGCCAGCAGCAGTGGCCAGGGG + Intergenic
950633961 3:14302316-14302338 CTGCCAACACCAGGGGCCAAGGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
952562477 3:34611362-34611384 CTTCCCACAGCAGTGGACTAAGG + Intergenic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957087299 3:75692865-75692887 CTGCCAACACTACTGGCCCATGG - Intergenic
957599137 3:82309499-82309521 TTTCCAACAACAGTGGCCAAGGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
959532936 3:107454184-107454206 CTGCCAACAGGACTGGCCCAGGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960158454 3:114322087-114322109 GAGCCAACAGCAGTGACCGGTGG - Intergenic
961178553 3:124857299-124857321 TTTCAAAGAGCAGTGGCCGAGGG - Intronic
961469140 3:127100604-127100626 CTGCCGTCAGCAGTGGGCCAGGG - Intergenic
961643150 3:128377823-128377845 CTTCCATCAGCAGTGGGTGAAGG + Intronic
963915312 3:150854370-150854392 CAGCAAACAGCAGTAGCAGACGG - Intergenic
964865912 3:161260580-161260602 TTCCCAACAGCAGTGTACGAGGG + Intergenic
968062753 3:195738758-195738780 CTGCCACCAGCAGGGGTCGGGGG + Intronic
969072268 4:4549070-4549092 CTGCCATCAGCAATGGCCTTGGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
969675361 4:8611459-8611481 CTGCCAACTGCAGTGGAAGCTGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977551338 4:98447048-98447070 TTGCCCACAGCAGTTGCCCAGGG + Intergenic
977575089 4:98666302-98666324 CTTCCAACAGCAGCTGCAGATGG - Intergenic
978765625 4:112402224-112402246 CTGCCAATTGCAGTGCCAGATGG + Intronic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
982128848 4:152208687-152208709 CTCCCACCAGCAGTGTCAGAGGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
985832091 5:2241162-2241184 CTGCCCACAGCAGGGCCCCACGG + Intergenic
985935582 5:3095206-3095228 GTGCCAAGGGCAGTGGCCGCAGG + Intergenic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
988330172 5:29827446-29827468 CTGCCATCAGCAGGGGGTGAGGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
995018571 5:107341585-107341607 CTGCCAAGAACAGAGGCCTAGGG + Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
999069668 5:148730573-148730595 CTGCCAACAGCAAGGGCTGAAGG + Intergenic
1001823074 5:174724884-174724906 CCGACAGCAGCAGTGGCCGCAGG - Exonic
1002953796 6:1842328-1842350 CTGCCCACAGCAGTAGCCTAAGG + Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005016566 6:21380167-21380189 ATTCCAACAGCAGTGGCCTGAGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006407426 6:33853315-33853337 CTGCCAACAGCCCTGGCCTGGGG + Intergenic
1007108994 6:39302199-39302221 CTGCCAACTGCAGTGGCCGCTGG + Intronic
1007621286 6:43216356-43216378 CTGCCAGCAGCAGTGGCTCAGGG - Exonic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008636911 6:53419770-53419792 CTACCAATAGCAGAGGCCAAAGG + Intergenic
1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG + Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011193935 6:84763635-84763657 CAGCAAACAGCCGCGGCCGAAGG + Intronic
1012946912 6:105476145-105476167 CTGCCATCAGCAGTGTACAAGGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1017523221 6:155220302-155220324 CTGCCTGCAGCTGTGGCAGAGGG + Intronic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1026341381 7:69436997-69437019 CTGCCAACAGTAATGGCCTTTGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1033354135 7:140585837-140585859 CTGCCAACAGGAGGGGCGCATGG - Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034285214 7:149879523-149879545 CTGGGCACAGCAGCGGCCGAGGG + Exonic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034950432 7:155293029-155293051 CTGCCAGGGGCAGTGGCAGAAGG - Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035239101 7:157518347-157518369 CAGCCCACAGTAGTGTCCGAGGG - Intergenic
1035458790 7:159026537-159026559 CTGCAGGCAGCAGTGGCCGGCGG - Intergenic
1036806246 8:11836322-11836344 GTTGCTACAGCAGTGGCCGAAGG - Intronic
1037014578 8:13886528-13886550 CCCCCAAAAGCAGTGGCAGAGGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1044609558 8:94078564-94078586 ATGCTAGCAGCAGTGGCCCAGGG + Intergenic
1044785661 8:95789666-95789688 CTTCCAAGAGCAGTGGCAGCAGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1049580671 8:143409146-143409168 CAGCCAACAGCTGGGGCTGAGGG + Intergenic
1051598542 9:18849414-18849436 TTCCCAACAGCTGTGGCCCAGGG - Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053750756 9:41251887-41251909 CTGCCAACACTACTGGCCCATGG - Intergenic
1053792768 9:41698858-41698880 CGGCCAACAGGAGTGGGCAAAGG + Intergenic
1054152407 9:61615967-61615989 CGGCCAACAGGAGTGGGCAAAGG - Intergenic
1054181181 9:61910879-61910901 CGGCCAACAGGAGTGGGCAAAGG + Intergenic
1054335036 9:63799383-63799405 CTGCCAACACTACTGGCCCATGG + Intergenic
1054472180 9:65547110-65547132 CGGCCAACAGGAGTGGGCAAAGG - Intergenic
1056608488 9:88107673-88107695 GTGCCAACATCAGTGGGCAATGG - Intergenic
1057962696 9:99471646-99471668 CTACCATCAGCAGTAGCAGAAGG + Intergenic
1058764502 9:108168285-108168307 CTGCCAAAAGGAGTGTCTGAAGG + Intergenic
1059300465 9:113308451-113308473 CTGCACACAGCAGAGGCCGGGGG - Intergenic
1060945589 9:127568199-127568221 CTGCTAGCAGCAGGGGCCCAGGG - Intronic
1061845797 9:133387336-133387358 CTGCCATTTGCAGTGGCCGTGGG - Intronic
1062153902 9:135035489-135035511 CTCCCATCAGCAGTGCCCAAAGG + Intergenic
1062367561 9:136218484-136218506 CTGGGAACAGCAGTGGACGCAGG + Intronic
1062380014 9:136282618-136282640 CTGCCCACACCTGTGGCCCAGGG + Intronic
1203369994 Un_KI270442v1:294382-294404 CTCCCAACAGCAGTGTACAAGGG + Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188199751 X:27283615-27283637 CTGCTAATAACAGTGGCCAATGG - Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1190938876 X:55021013-55021035 CAGCCATCAGCAGTGGCCAGAGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197887996 X:131238175-131238197 ATGCCAAAATCAGTGGCCCAAGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198430763 X:136564495-136564517 CTGCCACCAGCACAGGCCCATGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1201760837 Y:17536601-17536623 CTGCCAACACCACCGGCCCATGG + Intergenic
1201840715 Y:18369389-18369411 CTGCCAACACCACCGGCCCATGG - Intergenic