ID: 1096109741

View in Genome Browser
Species Human (GRCh38)
Location 12:49021560-49021582
Sequence CAGCCTGAGGGCCGGTGGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 353}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096109733_1096109741 0 Left 1096109733 12:49021537-49021559 CCTGGAGCTGGGGGCAGAGATGC 0: 1
1: 0
2: 4
3: 56
4: 583
Right 1096109741 12:49021560-49021582 CAGCCTGAGGGCCGGTGGTGGGG 0: 1
1: 0
2: 4
3: 27
4: 353
1096109730_1096109741 5 Left 1096109730 12:49021532-49021554 CCCCTCCTGGAGCTGGGGGCAGA 0: 1
1: 0
2: 6
3: 68
4: 441
Right 1096109741 12:49021560-49021582 CAGCCTGAGGGCCGGTGGTGGGG 0: 1
1: 0
2: 4
3: 27
4: 353
1096109732_1096109741 3 Left 1096109732 12:49021534-49021556 CCTCCTGGAGCTGGGGGCAGAGA 0: 1
1: 0
2: 9
3: 93
4: 683
Right 1096109741 12:49021560-49021582 CAGCCTGAGGGCCGGTGGTGGGG 0: 1
1: 0
2: 4
3: 27
4: 353
1096109731_1096109741 4 Left 1096109731 12:49021533-49021555 CCCTCCTGGAGCTGGGGGCAGAG 0: 1
1: 1
2: 10
3: 70
4: 576
Right 1096109741 12:49021560-49021582 CAGCCTGAGGGCCGGTGGTGGGG 0: 1
1: 0
2: 4
3: 27
4: 353
1096109723_1096109741 27 Left 1096109723 12:49021510-49021532 CCCAATGGCTGCTTCTGTCTGGC 0: 1
1: 0
2: 2
3: 13
4: 168
Right 1096109741 12:49021560-49021582 CAGCCTGAGGGCCGGTGGTGGGG 0: 1
1: 0
2: 4
3: 27
4: 353
1096109724_1096109741 26 Left 1096109724 12:49021511-49021533 CCAATGGCTGCTTCTGTCTGGCC 0: 1
1: 1
2: 2
3: 17
4: 270
Right 1096109741 12:49021560-49021582 CAGCCTGAGGGCCGGTGGTGGGG 0: 1
1: 0
2: 4
3: 27
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096109741 Original CRISPR CAGCCTGAGGGCCGGTGGTG GGG Exonic
900108824 1:997248-997270 AAGCCAGGGGGCAGGTGGTGTGG + Intergenic
900153696 1:1194498-1194520 CAGCCTGAAGGACGGTAGGGCGG + Intronic
900229982 1:1551793-1551815 AGGCCTGAGGGAGGGTGGTGGGG + Intronic
900408035 1:2500947-2500969 CAGCCTGAGGGTCCGAGATGGGG - Intronic
900924071 1:5692071-5692093 TGGCCTGGGGGCCGGGGGTGGGG + Intergenic
901323531 1:8353571-8353593 CAGGCTGAGGGCGGGTGTTCTGG - Exonic
902572702 1:17356819-17356841 CAGGCAGAGGGACGGGGGTGGGG + Intronic
902630549 1:17701951-17701973 GAGCCTGACTGCCTGTGGTGGGG + Intergenic
903320686 1:22541468-22541490 CAGACTGTGGGCCTGTGGAGGGG - Intergenic
903344928 1:22677835-22677857 CTGCCTGAGGGCCCATGCTGGGG - Intergenic
904160963 1:28521704-28521726 GAGCCTGAGGGAAGGTGGGGTGG - Intronic
904481932 1:30799424-30799446 CAGCCTGAGAGATGGGGGTGGGG + Intergenic
905028943 1:34868785-34868807 CGGCCCCAGGGCCGGGGGTGGGG + Exonic
905852690 1:41285933-41285955 CAAGCTGAGGGCCAGTGGGGTGG + Intergenic
906471178 1:46132602-46132624 GAGCTTGAGGGCAGTTGGTGCGG - Exonic
908420165 1:63951715-63951737 CAGCATGTGGGCTGGTGGTGAGG - Intronic
908817562 1:68049999-68050021 CAGCCTGAGGCCAGGTGGCCTGG - Intronic
910408416 1:86914636-86914658 CAGCCGCAGCGCCGGTGGAGGGG + Intronic
910647063 1:89525165-89525187 CAGGCTGCGGGCCGGTAGCGCGG + Intronic
911068011 1:93809387-93809409 AAGGCTGAGGGGTGGTGGTGGGG + Intronic
911210208 1:95131224-95131246 CAGCATGAGGGCAGGTAATGGGG + Intronic
913093407 1:115495007-115495029 CAGTCTGTGGGCCTGTGATGAGG - Intergenic
914858999 1:151371499-151371521 CAGCGAGAGGGCTGGAGGTGGGG + Intronic
914967931 1:152277805-152277827 CAGCCTCAGGGCAGTTGGGGAGG + Intergenic
915302995 1:154962053-154962075 TAGCCCGGGGGCCGGTGCTGGGG + Intronic
916166583 1:161971476-161971498 CAGCCTGAGCCCAGGTGCTGAGG - Intergenic
916585452 1:166145796-166145818 CAACCTGAAGGCCAGTAGTGTGG + Intronic
916854558 1:168736595-168736617 AATCCTGAAGGCAGGTGGTGGGG + Intergenic
919823045 1:201484838-201484860 CAGCAGGAGGGTGGGTGGTGTGG - Intronic
919864476 1:201770038-201770060 CAGCCAGAGGGCCAAGGGTGTGG - Intronic
920189310 1:204182473-204182495 CAGGCTGAGAGCTGGGGGTGGGG - Intergenic
921898390 1:220424516-220424538 CATCCTGAAGGCAGGTGGGGAGG - Intergenic
923526834 1:234779080-234779102 CAGCCTTGGGGCCGGTGGGGGGG + Intergenic
924720974 1:246622719-246622741 GAGCCTTTAGGCCGGTGGTGAGG + Intronic
924934653 1:248757750-248757772 CAGCCTGAAGGCAGATGGTGAGG - Intergenic
1062831314 10:607918-607940 CACACTGAGGGGCTGTGGTGTGG - Intronic
1063119071 10:3092091-3092113 AAGCTTGGGGGCCGGTGGCGGGG - Intronic
1063124164 10:3125024-3125046 CAGCCCCAGGGCCTGTGCTGAGG - Intronic
1063441215 10:6074862-6074884 CAGCCGAAGAGGCGGTGGTGAGG + Intergenic
1064701273 10:18023989-18024011 CAGCCTGAGGGCAGAAGGGGTGG + Intronic
1067087328 10:43249822-43249844 TGGCGTGGGGGCCGGTGGTGGGG - Intronic
1067800986 10:49359672-49359694 CAGCCTGAGTGGTGGTGGTGGGG - Intergenic
1068674711 10:59759008-59759030 CAGCCTGGGGCCGGGTGCTGTGG - Intergenic
1069661431 10:70126118-70126140 CAGGCAGAGGGCTGCTGGTGTGG + Intronic
1069943991 10:71973534-71973556 CAGCTTGAGGGCTGGAGGTGGGG - Intronic
1070450203 10:76550483-76550505 CACCATGGGGGCCGGGGGTGGGG - Intronic
1075023481 10:118967631-118967653 CACCCTGAAGTCCGGTGCTGGGG + Intergenic
1075651567 10:124130901-124130923 GAGCCTGAGAGCCTGAGGTGGGG - Intergenic
1075991569 10:126843001-126843023 CAGCCTGAGGGCGAGTGGCAGGG + Intergenic
1076033052 10:127175655-127175677 CCTCCTGAGGGCAGGTGGAGCGG + Exonic
1076537147 10:131186980-131187002 CAACCTAAGGGCTGGAGGTGTGG - Intronic
1076601660 10:131660672-131660694 CAGCCTTGGGGCAGGTGGGGGGG + Intergenic
1076633219 10:131865442-131865464 GAGCCTGAGGTCCGGTGATCAGG - Intergenic
1076701540 10:132275710-132275732 GAGCCTGAGAGAAGGTGGTGTGG - Intronic
1076829904 10:132988981-132989003 GGGCCTGAGGCCCGGTGGGGGGG + Intergenic
1076890677 10:133281740-133281762 AAGCGTGGGGGCCGGAGGTGAGG - Intronic
1076996464 11:299609-299631 CAGCCTGCGGGCCGAGGGTGCGG + Intergenic
1078549659 11:12271360-12271382 CAGCAAGAGGGCTGGTGGTGTGG + Intergenic
1078662312 11:13297439-13297461 CTGCCTGTGGGCCGGCAGTGAGG + Intronic
1080518930 11:33049687-33049709 CTGCCTTAGGGCTGGAGGTGAGG - Intronic
1082867726 11:57914867-57914889 CATTCTGAGGGATGGTGGTGGGG + Intergenic
1083261594 11:61525996-61526018 CAGCCTGGAGGCCTGAGGTGAGG + Intronic
1083633973 11:64110160-64110182 CAGCCTGAGGCCCGGCGTGGTGG + Intronic
1083773902 11:64883859-64883881 CAGCCTGTGAGCCCATGGTGAGG - Intronic
1084424449 11:69076930-69076952 CAGCAGGAGGGCAGGTGGAGGGG - Intronic
1084534995 11:69751295-69751317 CAGCCTGTGGGCTGGTGAGGAGG + Intergenic
1085332764 11:75667544-75667566 CAGCCTCGGGGCCGGTGGCCTGG + Exonic
1089664844 11:120011841-120011863 AGACCTGAGGGCTGGTGGTGGGG - Intergenic
1090231761 11:125111930-125111952 TAGCCTGAGGGCGGGTTGTTGGG + Intergenic
1090244590 11:125206936-125206958 GAGCCTGAGGGCCTGGGCTGAGG + Intronic
1090252906 11:125263778-125263800 CAGTCTGTGGACGGGTGGTGGGG - Intronic
1091061021 11:132462344-132462366 CAGCCTCAGGAAAGGTGGTGTGG - Intronic
1091206500 11:133824803-133824825 CTGCCTGTGGGCGAGTGGTGTGG - Intergenic
1091582530 12:1798025-1798047 GAGCCTGAGCGCCTGCGGTGGGG + Intronic
1091936988 12:4442214-4442236 CAGAGTGAGGGCTGGGGGTGGGG + Intronic
1092178429 12:6427120-6427142 CACCCTGTGGGCCGTTGCTGGGG - Intergenic
1095484012 12:42665519-42665541 CAGGCTAAGGGGTGGTGGTGGGG + Intergenic
1096109741 12:49021560-49021582 CAGCCTGAGGGCCGGTGGTGGGG + Exonic
1096142646 12:49255070-49255092 CAGCCTGAGGTCAGGTGCAGTGG - Intronic
1097109309 12:56646356-56646378 CAGCCATAGGGGCGGTGGTTAGG + Intergenic
1097274583 12:57803774-57803796 CAGGCTGAGGGACTGTGGTTTGG - Intronic
1097679294 12:62633646-62633668 CAGCCTGATGGCAGGAGATGGGG + Intergenic
1100102171 12:91122388-91122410 CAGCCAGAGAGCAAGTGGTGGGG - Intergenic
1101452248 12:104790219-104790241 CAGCAAAAGGGCCGGTGGGGAGG - Intergenic
1101488715 12:105192461-105192483 CAGGATGAGGGCGGGTGGGGAGG - Intronic
1101593001 12:106139519-106139541 CAGCCTGGCGGCCGGAGCTGGGG + Exonic
1103217009 12:119209309-119209331 CAGGCTGAAGGGCAGTGGTGCGG + Intronic
1104004938 12:124885224-124885246 CAGCCTGCCTGCCGGTGGAGGGG - Intergenic
1104599832 12:130145227-130145249 CAGCCTGAGCAAAGGTGGTGGGG - Intergenic
1105019434 12:132806052-132806074 CAGCGTGGGGGCAGGTGGTGGGG - Intronic
1105280995 13:18962525-18962547 GAGCCTGAGGGCAGACGGTGCGG + Intergenic
1105962660 13:25356127-25356149 CAACCTGGGGGGCAGTGGTGTGG + Intergenic
1106102890 13:26709789-26709811 CAGCCTGAGGTCCCGGGGAGGGG - Intergenic
1108800806 13:54092559-54092581 CAGCCTGAGGGCAGTAGGGGTGG + Intergenic
1110242446 13:73283970-73283992 GAGCCTGAGGGCAGGTGTTTGGG - Intergenic
1110804249 13:79736317-79736339 CAGCCTGAGGGCAGTTAGAGTGG + Intergenic
1112317344 13:98375024-98375046 CATCCTGAGTGCTGGAGGTGGGG - Intronic
1112972137 13:105273693-105273715 AAGCCTGAGGGCAGCAGGTGTGG + Intergenic
1116778857 14:49213235-49213257 CTGCCTGAGGGGCGGGGGTGGGG - Intergenic
1117196494 14:53345064-53345086 CAGCCTGCAGCCCGGTGGTCAGG + Intergenic
1119109826 14:71961071-71961093 GAACCTGAGGGTGGGTGGTGTGG + Intronic
1119208477 14:72812233-72812255 GAGGCTGGGGGCCGGGGGTGGGG - Intronic
1119658234 14:76432531-76432553 CAGGCTGAGTGGAGGTGGTGTGG + Intronic
1121055160 14:90846045-90846067 CACCCTCATGGCCAGTGGTGTGG + Intergenic
1121315834 14:92960564-92960586 AGGCCTGAGGGCCGGGGCTGTGG - Intronic
1121815204 14:96923791-96923813 CAGCCTGAGGCCCTGGGGGGAGG - Intronic
1122342204 14:101035709-101035731 CAGCCTGAGGACCTCTGGAGGGG + Intergenic
1122837057 14:104435535-104435557 CACCCTGAGGGCAGGTGCTGGGG + Intergenic
1122932194 14:104939124-104939146 CATCCTGAAGGCAGGTGCTGGGG - Exonic
1123401889 15:19995489-19995511 CAGCCTCAGGGCAGGTGCAGAGG - Intergenic
1123511229 15:21002152-21002174 CAGCCTCAGGGCAGGTGCAGAGG - Intergenic
1123578060 15:21692924-21692946 CAGCCTCAGGGCAGGTGCAGAGG - Intergenic
1123614685 15:22135406-22135428 CAGCCTCAGGGCAGGTGCAGAGG - Intergenic
1123706760 15:22956253-22956275 CAGCATGAGGGCAGGTGGCTGGG + Intronic
1124071021 15:26393329-26393351 CAGCCTGAGAGCCACTGGTGGGG + Intergenic
1124513943 15:30350327-30350349 CAGTCTGAGGTACGGTGGTTGGG + Intergenic
1124688421 15:31801352-31801374 CAGCCTGATGGCAGGTGGCCAGG + Intronic
1124728978 15:32180438-32180460 CAGTCTGAGGTACGGTGGTTGGG - Intergenic
1126572682 15:50168820-50168842 CAGACTTGGGGCCGTTGGTGGGG + Intronic
1128304045 15:66586562-66586584 ATGCCTGAGGGCCCTTGGTGGGG + Intronic
1129244671 15:74272039-74272061 AAGCTGGAGGGCAGGTGGTGGGG + Intronic
1129539362 15:76338233-76338255 CAGCCTGCGGGCCCAAGGTGCGG - Exonic
1130597469 15:85257490-85257512 CAGCTTGAGGGCCGTGGCTGAGG + Intergenic
1130932087 15:88436864-88436886 CAGTATGAGGGCAGGTGTTGTGG - Intergenic
1132206221 15:99987866-99987888 CAGCAGGAGGGTGGGTGGTGAGG + Intronic
1202986930 15_KI270727v1_random:427169-427191 CAGCCTCAGGGCAGGTGCAGAGG - Intergenic
1132453673 16:10737-10759 CGGCCTGGGGGCGGGGGGTGGGG + Intergenic
1132572121 16:648773-648795 CAGCCCCAGTGCCGGTAGTGGGG - Intronic
1132798786 16:1741313-1741335 GGGCCTGGGGGCCGGTGGGGAGG + Intronic
1133536434 16:6706472-6706494 CAGCCTGATGGCTGGTAATGAGG + Intronic
1136284070 16:29231049-29231071 CAGGGTGAGGGCCGATGGCGCGG - Intergenic
1136553861 16:30996794-30996816 CAGCCTGGGGGCCTGAGGTGGGG + Intronic
1137673723 16:50293549-50293571 CCGCCTGGGGGCCGGTGGAACGG - Intronic
1138340786 16:56287750-56287772 CAGCAAGAGGGCAGGTGCTGAGG - Intronic
1138543450 16:57702255-57702277 CAGCGGAAGGGCTGGTGGTGAGG - Intronic
1140480657 16:75261292-75261314 CAGACAGAGGGAAGGTGGTGTGG + Intronic
1141242772 16:82278469-82278491 CAGCCTGAGGGCCTGCCCTGTGG - Intergenic
1141330058 16:83102643-83102665 CACCCTGGGGGAGGGTGGTGAGG + Intronic
1141593304 16:85082714-85082736 CAGCCTGGTGGCCGGCGGGGAGG + Intronic
1141647728 16:85376491-85376513 GAGCCTGTGGCCGGGTGGTGTGG + Intergenic
1141721628 16:85759249-85759271 CAGCCTGGCCCCCGGTGGTGGGG + Intergenic
1142089102 16:88200557-88200579 CAGGGTGAGGGCCGATGGCGTGG - Intergenic
1142244320 16:88962559-88962581 CACCCTGAGGGCACGTGGTGGGG + Intronic
1142804115 17:2362585-2362607 CATCCTGAGGGCTGGGGCTGAGG - Intronic
1142809700 17:2389690-2389712 CAACCTGGGGGACAGTGGTGTGG + Intronic
1143591175 17:7886385-7886407 CAGCCAGAGGCCCGGGGGTGCGG - Intronic
1143688811 17:8542746-8542768 CAGCCTGAGTGACAGTGGAGTGG - Intronic
1144678436 17:17176668-17176690 CAGCCTGCAGGCAGGTGCTGTGG + Intronic
1146290434 17:31602872-31602894 CAGCCTGGGTGCTGTTGGTGAGG - Intergenic
1146896889 17:36548654-36548676 TAGCCTTAGGCCCGGTGCTGTGG + Intronic
1146926921 17:36751673-36751695 CAGCCTGAGGGCCTTTCCTGGGG + Intergenic
1147919018 17:43905367-43905389 CAGCCAGAGGGGCCGTGGAGAGG - Intronic
1147933703 17:43999127-43999149 CAGCCTGAGGCCAGGTGAAGGGG + Intronic
1148447081 17:47744361-47744383 CTGCCTGAGCCCCGGTGGGGAGG + Intronic
1150642433 17:66958614-66958636 CAGCATTAGGGCAGGTGCTGGGG + Intergenic
1151384686 17:73747808-73747830 AAGCCTGAGTGGCGGTGGCGGGG + Intergenic
1151617985 17:75226887-75226909 CAGCCTGAAGCCCAGTGGTTCGG - Intronic
1151747252 17:76018185-76018207 CCGCCTGAAGGCCAGTGCTGTGG - Exonic
1151854312 17:76710554-76710576 CAGCCGGAGCCCCGGGGGTGGGG + Intronic
1151857414 17:76731625-76731647 CAGTCTGAGGCCAGGTAGTGAGG - Intronic
1152945109 17:83193848-83193870 CACCCTGAGGGCTGATGGGGTGG - Intergenic
1153424273 18:4945322-4945344 CAGCCTGAGGGCGGTTAGGGTGG - Intergenic
1153965968 18:10182296-10182318 CAGACTCAGGGCTGTTGGTGGGG - Intergenic
1154217899 18:12428986-12429008 CGGCCTGAGGGCAGGTGCAGGGG + Intronic
1154322258 18:13364380-13364402 CAGGCTGAAGTGCGGTGGTGTGG + Intronic
1156514978 18:37671687-37671709 CAGGCAGAGGGCAGGTCGTGGGG - Intergenic
1156558910 18:38099314-38099336 AAACCTGAGGGCCAGAGGTGTGG - Intergenic
1157513751 18:48296378-48296400 CAGCCTTAGGCTTGGTGGTGAGG - Intronic
1157591098 18:48836860-48836882 CAGGCTGATGGCAGGTGATGTGG - Intronic
1159270161 18:66138552-66138574 CACCTTGAGGGCCAGTTGTGGGG - Intergenic
1160534156 18:79583457-79583479 CCCTCTGTGGGCCGGTGGTGTGG + Intergenic
1160929547 19:1563725-1563747 AAGCTTGAGGGCTGGGGGTGAGG - Intronic
1161124793 19:2549766-2549788 CAGCCAGCAGGCCGGGGGTGAGG + Intronic
1162524112 19:11197582-11197604 CAGCCGGAGGGGGCGTGGTGCGG - Intronic
1162562483 19:11425762-11425784 CAGCCTCAGGGCAGGTGCAGGGG + Intronic
1162770100 19:12944220-12944242 CAACCTGGGGGGCAGTGGTGTGG + Exonic
1162783120 19:13017474-13017496 CGATCTGAGGGCAGGTGGTGAGG + Intronic
1162789509 19:13055613-13055635 CAGCCTCAGGGCTGGGGGAGGGG + Intronic
1163090468 19:15016100-15016122 CAGGCTGAGGGTCGAGGGTGTGG + Intronic
1163649956 19:18511575-18511597 CAGACTGATGTCCTGTGGTGTGG - Intronic
1164108060 19:22126125-22126147 CAGGCTGAGGGCTGGTACTGGGG - Intergenic
1165842086 19:38794358-38794380 CAGCCTGAGGCCGGGCGCTGTGG + Intergenic
1166809422 19:45506866-45506888 CAGCCGCAGGGTCGGGGGTGGGG - Intronic
1168061282 19:53893673-53893695 CAGCCTGGGGGAGGGTGGTCAGG + Intronic
1168241153 19:55089500-55089522 CAGGCTGGGGGTTGGTGGTGAGG - Intergenic
925404892 2:3599673-3599695 CATCCTGAGGGCAGTGGGTGAGG - Intronic
925589299 2:5493800-5493822 CAGCATTAGGGCAGGTGGCGTGG - Intergenic
925684716 2:6458972-6458994 CAGCCTGAGGGTGGTTGGGGCGG + Intergenic
927678362 2:25123522-25123544 CTGCCTGAGTGCCTCTGGTGAGG + Intronic
928314701 2:30236268-30236290 GAGACTCAGGGCAGGTGGTGAGG + Intronic
929044337 2:37775569-37775591 CAGCCTGGCGGCGGGTGGGGGGG - Intergenic
930421946 2:51165265-51165287 CAGGCTCAGGGCTGGTGCTGGGG + Intergenic
931762747 2:65431897-65431919 CAGCGTGGGGGCCGGGGCTGAGG - Intronic
932430861 2:71672842-71672864 CAGACAGAGGGCTGGAGGTGAGG + Intronic
932580264 2:72988834-72988856 CAGCCTGTGGGCAGGTGTCGGGG - Intronic
937278925 2:120704126-120704148 CAGAAAGAGGGCCGGGGGTGGGG - Intergenic
937304058 2:120860406-120860428 CAGCCCCAGGGCCTGTGTTGGGG - Intronic
937305389 2:120867546-120867568 CACCCAGAGGGGCGGCGGTGCGG - Intronic
938077070 2:128345773-128345795 CGGCCTCAGGGCCGGGGTTGGGG - Intergenic
946225469 2:218261957-218261979 CAGCCTCAGGCCTGGGGGTGTGG + Intronic
947528589 2:230894387-230894409 CAGCCTCGGGGCACGTGGTGTGG - Intergenic
947948228 2:234124790-234124812 CACCCTGGAGGCTGGTGGTGAGG - Intergenic
948506011 2:238427247-238427269 CACCCTGCAGGCCGGGGGTGGGG + Intronic
1170429215 20:16261370-16261392 CAGCCTAAGGGCAGGTCCTGGGG + Intergenic
1171086159 20:22240017-22240039 AAACCTGAGGGTCTGTGGTGGGG + Intergenic
1171294567 20:24006066-24006088 CAGCCTGGGGGCTGGAGGTCGGG + Intergenic
1172278325 20:33693449-33693471 CAACCTGAGGGCCTGTGACGTGG - Intergenic
1172620566 20:36315932-36315954 CAGCCTGGGAGGGGGTGGTGTGG + Intronic
1173617110 20:44410484-44410506 CAGGCTGAGGAGGGGTGGTGGGG - Intronic
1173837395 20:46134875-46134897 CAGCCAGTGGGCAGGGGGTGAGG + Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1175080888 20:56419454-56419476 CAGCCTGAGCGGGGGTGGTGTGG - Intronic
1175249106 20:57598187-57598209 CAGCTGGGGGGCCGGGGGTGGGG - Intergenic
1175828962 20:61951706-61951728 CAGGGTGAGGCCCTGTGGTGGGG + Intergenic
1175958649 20:62624046-62624068 CAGCCTCAGGGGCGGGGCTGTGG + Intergenic
1175993203 20:62799760-62799782 GAGCCTGAGGGCGGGCAGTGTGG - Exonic
1176064303 20:63186861-63186883 CAGCCTGAGGACCTGTGGAGGGG + Intergenic
1176081488 20:63275654-63275676 AAGCCTTAGGGCGGGGGGTGGGG - Intronic
1176101936 20:63368379-63368401 CAGCCAGAGGGCAGGGTGTGAGG - Intronic
1176135787 20:63521445-63521467 CGGCCTGAAGGCCGGTGGGCTGG + Intronic
1176302704 21:5106153-5106175 CAGCCTGAGGACCGGCAATGTGG + Intergenic
1179714228 21:43279630-43279652 CCGCCCGAGGGCCGGAGGGGAGG + Intergenic
1179854320 21:44155770-44155792 CAGCCTGAGGACCGGCAATGTGG - Intergenic
1179878649 21:44284378-44284400 CAGCCTGGGGTCAGGTGCTGGGG - Intergenic
1180175300 21:46084296-46084318 CAGCCACAGGGCCGGGTGTGGGG - Intergenic
1180623950 22:17181602-17181624 CAGCCTCAGGGCAGGGGTTGGGG + Intronic
1180908361 22:19431563-19431585 CGGCCGGAGGGCGGGTGGCGCGG - Exonic
1180938985 22:19644597-19644619 CAGCCTGAGAGCCAGCGGTGGGG - Intergenic
1181161793 22:20964155-20964177 CACACTGGGGGCAGGTGGTGGGG - Intergenic
1182165701 22:28170847-28170869 GAGCCTGAGAGGGGGTGGTGAGG - Intronic
1182439819 22:30356704-30356726 CAGGCTGAGGGGCGGGGGAGAGG + Exonic
1183158778 22:36096214-36096236 GAGGCTGAGGGCGGGGGGTGGGG - Intergenic
1183341746 22:37285265-37285287 CAGCCTGTGGGCTTGGGGTGGGG + Intronic
1183433275 22:37778830-37778852 GGGCCTGAGCGCCGGAGGTGTGG + Intergenic
1183445308 22:37849593-37849615 CAGCCTGAGGGCCGGGCGGGAGG - Intronic
1183469888 22:37999589-37999611 CAGCCTGAGGCCCTGGGGAGGGG - Intronic
1183476316 22:38038079-38038101 GAGCCTGAGAGCCAGTGTTGGGG + Intronic
1183979061 22:41529234-41529256 CAGCCTGCGGGAAGGTGGTATGG - Exonic
1184309327 22:43631095-43631117 CAGCCTGGGGGGCTGTGGGGAGG - Intronic
1184406903 22:44305547-44305569 CAGCCTGAAGGCGGGGGCTGGGG + Intronic
1184455420 22:44607248-44607270 CAGAGGGATGGCCGGTGGTGGGG + Intergenic
1184857754 22:47155765-47155787 CACCCTCAGGGGCGGTGGTGCGG + Intronic
1184898015 22:47423555-47423577 CAGACTGAGTGCCTGTGATGTGG + Intergenic
1185052669 22:48562023-48562045 CAGCCTGGCAGGCGGTGGTGTGG + Intronic
1185116351 22:48940430-48940452 CAGCCTGAGGCAGGGTGGTCAGG + Intergenic
1185206536 22:49542008-49542030 CAGCCTGGGGGGCGGGGGTCAGG - Intronic
1185333080 22:50260355-50260377 CAGCCTGAGGGCTGGTGGTCTGG - Intronic
950111425 3:10421146-10421168 CAGCCTGAGGGAGGAGGGTGAGG + Intronic
950164200 3:10781137-10781159 CAGCCAGAGGGCGGGGGGCGGGG + Intergenic
950446378 3:13041210-13041232 AAGCCTGGGGGCGGGGGGTGGGG + Intronic
950536009 3:13578765-13578787 CAGCCTGAGGCCGGGTGTGGTGG + Intronic
950673700 3:14541769-14541791 CAGCCACAGGGTGGGTGGTGAGG + Intronic
953674886 3:44993303-44993325 CAGCCTTAGGGCCTGTGTTGGGG + Intronic
953890878 3:46750790-46750812 CAGCCTCATGGCCGGGCGTGGGG - Intronic
954316065 3:49802638-49802660 CAGACTGAGGGTCGGTGCTGAGG - Intergenic
954971065 3:54652145-54652167 CAGCCAGAGTGACGGTCGTGTGG - Intronic
955000046 3:54919192-54919214 CACGCTGGGGGCCGATGGTGAGG + Intronic
956446067 3:69327047-69327069 CAGCCTGTGGGTTGGGGGTGGGG + Intronic
956728780 3:72177903-72177925 CAGCCTTAGGGCCGTCGGTCTGG - Intergenic
956873846 3:73443072-73443094 CACCCACTGGGCCGGTGGTGGGG - Intronic
958497597 3:94864508-94864530 CAGCCTGAGGGGAAGTGGAGAGG + Intergenic
958614056 3:96467780-96467802 CAGCCTGTTGGCGGGTGGGGCGG - Intergenic
960906317 3:122605190-122605212 CTGGATGAGGGCTGGTGGTGGGG + Intronic
961336990 3:126186521-126186543 GAGCCTGAGGGCTTGGGGTGTGG + Intronic
961366476 3:126402801-126402823 CTGCCTGGGGGTCGGTGGTGGGG + Intronic
961596579 3:128022629-128022651 CTGCCTGAGGGCCAGGGCTGGGG - Intergenic
961626122 3:128264905-128264927 CAGCCAGAGGGGAGGTGGGGCGG - Intronic
962207262 3:133445196-133445218 CAGACTGAGGGCTGGGAGTGGGG + Intronic
962893340 3:139692285-139692307 CAGCCTTGGGGGTGGTGGTGGGG + Intergenic
965345213 3:167540380-167540402 CAGCCTTTGGGCTGGTGCTGGGG - Intronic
965837897 3:172871235-172871257 CAGCCTGGGGGCTGGGCGTGGGG + Intergenic
968426684 4:528412-528434 CAGCCTGAGGGGTGGCCGTGGGG + Intronic
968562573 4:1292355-1292377 CAGCGTCAGGGCGGCTGGTGGGG + Intronic
968626001 4:1626961-1626983 CTGCCTGAGGGCAGGGGCTGTGG + Intronic
970401095 4:15718688-15718710 CAGCTTCAGGCCCGGTGCTGGGG + Intronic
971207349 4:24583881-24583903 CAGCCAGAGGGGCCGTGGGGAGG - Intronic
973699612 4:53523572-53523594 CAGCTTGAGGCCAGGTGCTGTGG - Intronic
975738135 4:77401611-77401633 CTGCCTGAGTCCCAGTGGTGAGG + Intronic
975800741 4:78057363-78057385 CAGCCTGAGGCGGTGTGGTGCGG + Intergenic
978124694 4:105121790-105121812 CAGGCTGAAGGGCTGTGGTGTGG - Intergenic
978670669 4:111244256-111244278 CAGTCTGGGGGCTGTTGGTGGGG + Intergenic
982189968 4:152843769-152843791 CAGACTCAGGGCTGTTGGTGGGG - Intronic
982211815 4:153043440-153043462 CAGCATGATTGCCTGTGGTGAGG - Intergenic
983247841 4:165309098-165309120 CAGCCTGAGGGCAGGCAATGTGG - Intronic
985721347 5:1490906-1490928 CAGCCTAGGAGCCCGTGGTGGGG - Intronic
985725333 5:1513149-1513171 CAGCCTGGGGACCGGAGGAGCGG - Intronic
986221213 5:5770565-5770587 CAGCCTGAGGGATTGGGGTGGGG + Intergenic
986414189 5:7511780-7511802 CAGCAGGAGGGCCGGTGTAGAGG + Intronic
987821427 5:22970969-22970991 CAGCCTGAGGGCAGTAGGGGTGG + Intergenic
990533466 5:56696943-56696965 CAGCCTGAGAGCCCCTGCTGAGG - Intergenic
991726101 5:69537240-69537262 CAGCCTGGGGTGCAGTGGTGTGG + Intronic
991868855 5:71090632-71090654 CAGCCTGGGGTGCAGTGGTGTGG - Intergenic
992894634 5:81235470-81235492 CAGCCAGAGGGCAGGTGGAAGGG - Intronic
992982328 5:82188659-82188681 AAGCCTGGGGGCTGGGGGTGAGG + Intronic
996137996 5:119868894-119868916 CAGCCTGATGGAAGGTGCTGAGG + Intergenic
997294293 5:132760218-132760240 CAGTCTGTGGGGCAGTGGTGTGG - Intronic
997347468 5:133202344-133202366 GAACCTGAGGGGTGGTGGTGGGG + Intronic
999235853 5:150093364-150093386 TAGCATGAGGGCCGGTGCTGTGG - Intronic
999318567 5:150599691-150599713 GAGCCTGGGGGTCGGCGGTGGGG + Intergenic
999622855 5:153490302-153490324 CAGCCTGGGGGCTGGGGGAGCGG + Intronic
1002165074 5:177338855-177338877 CAGCCTGAGGTCTGCTGGCGGGG - Intronic
1003244551 6:4373048-4373070 GGGCCTGAGGGCCTGTGTTGTGG - Intergenic
1004445172 6:15691418-15691440 CAGCCTGAGGTCCGGTCCTGAGG + Intergenic
1008220148 6:48844930-48844952 CAGCCTGAGGGCAGTTAGGGTGG + Intergenic
1009899764 6:69796901-69796923 CAACCTGAGCGCCCGGGGTGGGG + Exonic
1009995717 6:70893014-70893036 CTGGCTGAGGGCTGGTGCTGTGG + Intronic
1012075734 6:94682515-94682537 CAGCTGGAGGGCCGGTGCAGGGG + Intergenic
1015163170 6:130175313-130175335 CAGGCTGAGGGCCCGTGGGAGGG - Intronic
1015928633 6:138334777-138334799 GAGCCTGAAGGCCGGTGGTGGGG + Exonic
1017028690 6:150202360-150202382 CAGCCTGAGGCAAGGAGGTGTGG - Intronic
1017925877 6:158911450-158911472 TAGCCTGATGGCGGGTGGCGGGG + Intergenic
1020212900 7:6168964-6168986 TAGAGTGAGGGCCGGTGGGGGGG - Intronic
1020860762 7:13489386-13489408 CAGACTCAGGGCTGTTGGTGGGG + Intergenic
1022002824 7:26242390-26242412 CAGCATGAGGGCTGGAGTTGAGG + Intergenic
1023938865 7:44757597-44757619 CAGCCTGAGGGCCTGGGAGGAGG + Intronic
1024056472 7:45662799-45662821 AAGCCTGGGGTCCGGGGGTGGGG - Intronic
1026858683 7:73770769-73770791 CAGCCTGAGTCCGGGCGGTGGGG + Intergenic
1026979438 7:74517954-74517976 CAGGCTGGGGGTGGGTGGTGTGG - Intronic
1028456900 7:91048176-91048198 TATGCTGAGGGCCTGTGGTGGGG - Intronic
1029448266 7:100626892-100626914 CAGCCCGCGGGCCTGGGGTGGGG + Exonic
1031642013 7:124176160-124176182 CAGCCTGAGGGTGGTGGGTGAGG - Intergenic
1032075087 7:128832304-128832326 AAGGCTGAGGGCAGGGGGTGGGG + Intronic
1033138097 7:138801426-138801448 CAGGCTGAGGGCCAGTTCTGGGG - Intronic
1033223312 7:139542961-139542983 CAGCCGGAGGGCATGGGGTGGGG + Intronic
1033239921 7:139669642-139669664 CAGCCAGTGGGCGGGTGGGGGGG + Intronic
1034008669 7:147504233-147504255 CAGCCTGAGAGCAGCTGCTGTGG + Intronic
1034386961 7:150748032-150748054 CACCCTGAGGGCCTGGGCTGGGG + Intronic
1035245804 7:157561362-157561384 GAAACTGAGGGCCAGTGGTGAGG - Intronic
1035593578 8:836609-836631 CGGCCTGTGGGCAGGGGGTGGGG + Intergenic
1038284680 8:26196431-26196453 CAGCCTTAGGGCCTCTGGAGGGG - Intergenic
1041166910 8:55101122-55101144 CCGCCCGCGGGCCGGGGGTGGGG + Intergenic
1047723993 8:127668857-127668879 CAGCCTGAAGGCCAGCGGGGAGG + Intergenic
1048010106 8:130448641-130448663 CAGCTTGTTGGCTGGTGGTGGGG + Intergenic
1048568454 8:135628990-135629012 TAGCCTGAAGGCCAGTGGTTGGG + Intronic
1048572469 8:135667187-135667209 CAGCCTGAGGCCCAGTGGGCAGG - Intergenic
1049022624 8:139968249-139968271 CAGGCTGTGGGCCAGGGGTGCGG - Intronic
1049023213 8:139971479-139971501 CAGCCTGGGTGCAGGTGTTGGGG - Intronic
1049475785 8:142796360-142796382 CAGGATGTGGGCCTGTGGTGGGG + Intergenic
1049573199 8:143379062-143379084 CTTCCAGAGGGCCGCTGGTGAGG + Exonic
1049615211 8:143572924-143572946 CAGCCTGAGTGCCTGTGGTGTGG + Exonic
1049794771 8:144492092-144492114 CAGCCGGAGGGCAGGTGGTGTGG + Intronic
1051847281 9:21465649-21465671 CAGCCTGAGTGCCAGTGGCCAGG + Intergenic
1052049140 9:23825227-23825249 CCGCCTGAGGGCTGGGGCTGGGG - Intronic
1052989506 9:34510956-34510978 CAGCCTGAGGCCTGGTGGATCGG - Intronic
1054914652 9:70484750-70484772 CAGCCTGAGGATCAGTGGAGAGG + Intergenic
1056114859 9:83432160-83432182 CATCCAGAGGGCCGGATGTGGGG - Intronic
1056521689 9:87407854-87407876 GAGCCTGAGGCCAGGTGCTGTGG + Intergenic
1056540088 9:87563725-87563747 CAGTCTGAGAGGCGGTGGGGTGG - Intronic
1056754439 9:89373117-89373139 GAGCTTGAGGCCTGGTGGTGGGG - Intronic
1056923865 9:90815583-90815605 GAGCCTGAGTGCTGGTGGTGGGG - Intronic
1057269998 9:93645279-93645301 CAGCCCGGGTGCCGGTGGTTGGG + Intronic
1057757146 9:97847815-97847837 CAGCCTGCGGGCTGGAAGTGAGG - Intergenic
1057814572 9:98285160-98285182 CAGGCTGAGGGCCGGAGGGCTGG - Intergenic
1057847642 9:98537945-98537967 CAGCCTGGGGGTGAGTGGTGAGG - Intronic
1059414891 9:114156261-114156283 CAGCCCGGGGGTCGGGGGTGGGG + Intronic
1059563923 9:115363635-115363657 CAGTCTGTGGGCCAGGGGTGGGG + Intronic
1060074763 9:120581090-120581112 CAGCCAAGGGGCCGGTGCTGTGG - Intergenic
1060413304 9:123413894-123413916 CAGCCTGTGCACCGGTGGAGGGG - Intronic
1061444160 9:130628377-130628399 CAGCCAGGGGGCCACTGGTGGGG + Intronic
1061732801 9:132629512-132629534 CAGCCTGGGGGCCTGTTGTGGGG - Intronic
1062003025 9:134226268-134226290 CATCTGGAGGGCCGGTGGCGCGG + Intergenic
1062077715 9:134600952-134600974 AAGCCAGAGGGCGGGTGATGGGG - Intergenic
1062159770 9:135073867-135073889 CACCCTGAGGGCCTTTGCTGTGG - Intergenic
1062289915 9:135789832-135789854 GTGCCTGAGGGCCTGGGGTGGGG - Intronic
1062320129 9:135986674-135986696 CTGCCTGGGAGCCGGTGCTGAGG - Intergenic
1062380252 9:136283669-136283691 CAGCCAGAGGGGCAGAGGTGCGG - Intronic
1062404443 9:136388410-136388432 CAGCCTGAGAGCCGTCGGGGTGG + Intronic
1062428593 9:136517120-136517142 CGGCCCGAGGGCAGGGGGTGGGG + Intronic
1062430663 9:136525611-136525633 CAGCTTCAGGGCCGGTCCTGGGG - Intronic
1185609860 X:1387769-1387791 CATCCTGAGGTCCTGGGGTGGGG - Intronic
1187277358 X:17827835-17827857 CAGGCTGAGGGAAGGTGGGGAGG + Intronic
1189159948 X:38801402-38801424 AAGCCAGAGGGGCGGTGGTGGGG + Intergenic
1190962405 X:55265604-55265626 CAGCTTGAGGGCAGGAGATGTGG - Intronic
1190968280 X:55323476-55323498 CAGCCTGATGGCTGGGGCTGTGG + Intergenic
1191080426 X:56504673-56504695 CAGGCTGGGGGCTGGTGCTGGGG - Intergenic
1192230930 X:69264505-69264527 CAGCATGGGGGCAGGTGGGGAGG + Intergenic
1192363781 X:70454991-70455013 TAGCCTGCGGGCCAGTGGAGTGG + Intronic
1194366352 X:93018878-93018900 CAGCCTGAGAGCAGCAGGTGTGG - Intergenic
1195049313 X:101082426-101082448 CATCCTAAGGGCGGGGGGTGGGG + Intronic
1195252603 X:103063617-103063639 CAGTGCGAGGGACGGTGGTGGGG - Intronic
1195278801 X:103310333-103310355 CAGTGCGAGGGACGGTGGTGGGG - Intronic
1196393518 X:115234120-115234142 CAGACTGGGGGCGGGGGGTGGGG + Intergenic
1197623821 X:128781128-128781150 CAGCCTGAGGGCAGTAGGGGCGG - Intergenic
1200096633 X:153667653-153667675 CAGGCTCAGGGCTGGTGCTGAGG - Intergenic
1200233900 X:154459171-154459193 CAGCTTGAGGGCGGGAGGCGGGG - Intronic