ID: 1096111687

View in Genome Browser
Species Human (GRCh38)
Location 12:49032550-49032572
Sequence CAGGGAGGGCCGTTAGCAAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096111687_1096111694 0 Left 1096111687 12:49032550-49032572 CCTATTGCTAACGGCCCTCCCTG 0: 1
1: 0
2: 1
3: 2
4: 63
Right 1096111694 12:49032573-49032595 ATGTGTAGAGGGCCCCTCAGTGG 0: 1
1: 0
2: 0
3: 12
4: 87
1096111687_1096111699 19 Left 1096111687 12:49032550-49032572 CCTATTGCTAACGGCCCTCCCTG 0: 1
1: 0
2: 1
3: 2
4: 63
Right 1096111699 12:49032592-49032614 GTGGCCTCTGAAGAAACGGCTGG 0: 1
1: 0
2: 3
3: 10
4: 133
1096111687_1096111700 20 Left 1096111687 12:49032550-49032572 CCTATTGCTAACGGCCCTCCCTG 0: 1
1: 0
2: 1
3: 2
4: 63
Right 1096111700 12:49032593-49032615 TGGCCTCTGAAGAAACGGCTGGG 0: 1
1: 0
2: 3
3: 9
4: 125
1096111687_1096111698 15 Left 1096111687 12:49032550-49032572 CCTATTGCTAACGGCCCTCCCTG 0: 1
1: 0
2: 1
3: 2
4: 63
Right 1096111698 12:49032588-49032610 CTCAGTGGCCTCTGAAGAAACGG 0: 1
1: 0
2: 2
3: 20
4: 295
1096111687_1096111702 27 Left 1096111687 12:49032550-49032572 CCTATTGCTAACGGCCCTCCCTG 0: 1
1: 0
2: 1
3: 2
4: 63
Right 1096111702 12:49032600-49032622 TGAAGAAACGGCTGGGTCTACGG 0: 1
1: 0
2: 1
3: 21
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096111687 Original CRISPR CAGGGAGGGCCGTTAGCAAT AGG (reversed) Exonic
900370047 1:2328254-2328276 CAGGGAGGGCGGTTTGCAGCGGG + Intronic
903553922 1:24179740-24179762 CACGTAGGGCCCTTAGCACTTGG + Intronic
903741181 1:25559597-25559619 CAGGGAGGCCAGGTAGCAAAGGG - Intronic
912106003 1:106276460-106276482 CAGTGAGGTCCATTCGCAATAGG + Intergenic
914905477 1:151740176-151740198 CAGGGAGGGCCACTGGCAGTAGG + Intergenic
916058010 1:161081275-161081297 CAGGGAGTGCCATGAGCAAGTGG + Intronic
1063609689 10:7552205-7552227 CAGGGAGGACCTGAAGCAATTGG + Intergenic
1066650536 10:37650938-37650960 GTGGGAGGACCATTAGCAATGGG + Intergenic
1067033543 10:42897077-42897099 GCGGGAGGACCATTAGCAATGGG + Intergenic
1070716668 10:78727359-78727381 CTGGCTGGGCCGTAAGCAATGGG + Intergenic
1074849906 10:117431403-117431425 CAGGCAGAGCCGTCAGCACTCGG + Intergenic
1076701999 10:132278096-132278118 CAGAGAGGGGTGTGAGCAATGGG - Intronic
1080389202 11:31828130-31828152 CAGGGAGGGGCGTTAAGAAGAGG - Intronic
1081610967 11:44563228-44563250 CAGGGACGGCCGGTGGCAGTGGG + Intergenic
1088965837 11:114720234-114720256 CATGGAGGGCCCTGAGCCATTGG + Intergenic
1094456309 12:30638400-30638422 TAGGGTGGGGCGTTAGGAATGGG - Intronic
1096111687 12:49032550-49032572 CAGGGAGGGCCGTTAGCAATAGG - Exonic
1098158396 12:67623844-67623866 CAAGGAGGGCCATTCGCATTTGG - Intergenic
1105684305 13:22763108-22763130 CAGGGAGGGCAATTATCACTGGG + Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1119006546 14:70936260-70936282 GAGGGAGGAGCGATAGCAATAGG - Intronic
1119744520 14:77034292-77034314 AAGGGAGGGCGCTTAGCATTTGG + Intergenic
1121444923 14:93972779-93972801 CAGGGTGGGCCTTTGGCCATGGG + Intronic
1125749844 15:42020807-42020829 CAGGGAGGGCTGGTAGGCATTGG - Intronic
1131003059 15:88953903-88953925 CAGGGACGGCCGTGATCAAGTGG - Intergenic
1132014045 15:98300333-98300355 CGGGAAGGGCCGTCAGCAAAGGG - Intergenic
1146657735 17:34644999-34645021 CAGGGAGGGCTGTTAGACACTGG - Intergenic
1151939364 17:77282906-77282928 CAGGGAGGGCCCTTTGCCCTTGG + Intronic
1157508379 18:48248446-48248468 CAGGGAGGGCCAGTATCAAAAGG - Intronic
1162949044 19:14059788-14059810 CAGGGAGGGGGGTTAGCAGGTGG - Intergenic
1163380049 19:16960036-16960058 CAGGGAGGGAAATTAGCAAAGGG - Intronic
1167966089 19:53148381-53148403 CAGGGAGGGCTGTTACAAAAGGG - Intronic
926384654 2:12324233-12324255 CCATGAGGGCAGTTAGCAATGGG + Intergenic
930328183 2:49946914-49946936 CAGTGAAGATCGTTAGCAATTGG + Intronic
939966497 2:148615536-148615558 CATTCAGGGCCGTTAGCACTGGG - Intergenic
943190008 2:184663597-184663619 CAGGGATGGCCGGAAGCAATGGG + Intronic
1169076212 20:2761100-2761122 CTGGGAGGGCCCTGGGCAATGGG - Intergenic
1170695243 20:18651968-18651990 GAGGTAGGGCCGTTAGCCACTGG + Intronic
1173756437 20:45520892-45520914 CAGGCAGGACCATTAGCAAATGG - Intergenic
1175477594 20:59288005-59288027 TAGGGGGGGCCGTTTACAATGGG - Intergenic
1175541998 20:59753851-59753873 CAGGGATGGCAGGTAGGAATCGG + Intronic
1175640273 20:60623767-60623789 CAGGGAGGGCAGTGAATAATTGG - Intergenic
1177892810 21:26826734-26826756 TAGGTAGGGCAGTTAGCAAGAGG - Intergenic
1181988374 22:26817819-26817841 CAGAGAGGGTCTTAAGCAATTGG - Intergenic
1182791513 22:32957046-32957068 CAGGAAGGGCCCTTAGGTATTGG + Intronic
1183740094 22:39664463-39664485 CAGGGCGGGCAGTTTTCAATTGG + Intronic
1185328046 22:50237161-50237183 CAGGGAGGGCCGTGAGCAGTCGG + Intronic
949350505 3:3120863-3120885 CAGGGAGTGCTGTTAGCATCTGG - Intronic
964475753 3:157096234-157096256 CTGGGAGGGCAGCTAGGAATGGG + Intergenic
972608206 4:40633042-40633064 CGGGGAGGGCAGTGAGAAATAGG - Intergenic
990242353 5:53828016-53828038 CATGGTGGGCCCTTAGCCATGGG - Intergenic
992239067 5:74746760-74746782 CAGGCAGTGCCATTGGCAATGGG - Intronic
992953254 5:81881587-81881609 CAGGGAGGGAAGATAGAAATAGG + Intergenic
1000612182 5:163386426-163386448 CAGTGAAGGCAGTTACCAATTGG + Intergenic
1004022449 6:11787785-11787807 TAAGGGGGGCCGTTAGTAATGGG - Intronic
1005157379 6:22822151-22822173 CAGTGAGGGCCTGTAGGAATTGG - Intergenic
1012408747 6:98931686-98931708 CAATGAAGGACGTTAGCAATGGG - Intronic
1015924152 6:138292671-138292693 CAGGGAGGACCGTCAGGAAGGGG + Intronic
1022879201 7:34568007-34568029 CAGGGAGGAGAGTAAGCAATGGG + Intergenic
1029405783 7:100373428-100373450 AAGGGAGGCCCTTTTGCAATAGG + Exonic
1035117083 7:156533649-156533671 CAGGGAGGGCCGTTCGCATGAGG - Intergenic
1035239240 7:157519354-157519376 CAGGGAGGCCCGGGAGCTATGGG - Intergenic
1040897954 8:52388708-52388730 CAGGGAGGGCCTTTCTCAAAAGG + Intronic
1046137680 8:110050962-110050984 CAGGGTGGGCAATTAGCAAAGGG + Intergenic
1049065509 8:140310651-140310673 CTGGGAGAGCAGTGAGCAATGGG + Intronic
1056129576 9:83570795-83570817 CAGGGAGACCAGTTAGGAATCGG + Intergenic
1194038460 X:88910393-88910415 GAGGGAGGGGGGTTAGCATTGGG + Intergenic