ID: 1096111750

View in Genome Browser
Species Human (GRCh38)
Location 12:49033148-49033170
Sequence GGGCCTTATGGGACACAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 195}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096111750_1096111757 -1 Left 1096111750 12:49033148-49033170 CCAGCCTGTGTCCCATAAGGCCC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1096111757 12:49033170-49033192 CTGACCCTGCTGTGCCAGCTGGG 0: 1
1: 0
2: 5
3: 20
4: 274
1096111750_1096111767 23 Left 1096111750 12:49033148-49033170 CCAGCCTGTGTCCCATAAGGCCC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1096111767 12:49033194-49033216 GGAACTGAGCACCCGGGACTGGG 0: 1
1: 0
2: 0
3: 10
4: 140
1096111750_1096111760 2 Left 1096111750 12:49033148-49033170 CCAGCCTGTGTCCCATAAGGCCC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1096111760 12:49033173-49033195 ACCCTGCTGTGCCAGCTGGGGGG 0: 1
1: 0
2: 5
3: 30
4: 286
1096111750_1096111756 -2 Left 1096111750 12:49033148-49033170 CCAGCCTGTGTCCCATAAGGCCC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1096111756 12:49033169-49033191 CCTGACCCTGCTGTGCCAGCTGG 0: 1
1: 0
2: 2
3: 48
4: 338
1096111750_1096111758 0 Left 1096111750 12:49033148-49033170 CCAGCCTGTGTCCCATAAGGCCC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1096111758 12:49033171-49033193 TGACCCTGCTGTGCCAGCTGGGG 0: 1
1: 0
2: 5
3: 43
4: 361
1096111750_1096111765 17 Left 1096111750 12:49033148-49033170 CCAGCCTGTGTCCCATAAGGCCC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1096111765 12:49033188-49033210 CTGGGGGGAACTGAGCACCCGGG 0: 1
1: 0
2: 3
3: 24
4: 223
1096111750_1096111759 1 Left 1096111750 12:49033148-49033170 CCAGCCTGTGTCCCATAAGGCCC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1096111759 12:49033172-49033194 GACCCTGCTGTGCCAGCTGGGGG 0: 1
1: 0
2: 1
3: 34
4: 263
1096111750_1096111766 22 Left 1096111750 12:49033148-49033170 CCAGCCTGTGTCCCATAAGGCCC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1096111766 12:49033193-49033215 GGGAACTGAGCACCCGGGACTGG 0: 1
1: 0
2: 1
3: 10
4: 137
1096111750_1096111764 16 Left 1096111750 12:49033148-49033170 CCAGCCTGTGTCCCATAAGGCCC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1096111764 12:49033187-49033209 GCTGGGGGGAACTGAGCACCCGG 0: 1
1: 0
2: 2
3: 16
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096111750 Original CRISPR GGGCCTTATGGGACACAGGC TGG (reversed) Exonic
900228950 1:1546400-1546422 GGGGCCTCGGGGACACAGGCGGG - Intronic
900392255 1:2438793-2438815 GGCCCTTCTGGCACACAGGGAGG - Intronic
900645950 1:3708820-3708842 GGGCTCTATGGGACACATGTTGG + Intronic
901780923 1:11594053-11594075 GGGCCAGAAGGGACACAGGGAGG - Intergenic
903999741 1:27332163-27332185 AGGCCTTCTGGGGCACAGGAGGG + Intronic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
904976665 1:34461869-34461891 GAGCCTGAGGGGACTCAGGCTGG - Intergenic
905166928 1:36088472-36088494 GGGCCAACTGGGACACAGCCAGG - Intergenic
912179033 1:107195531-107195553 GGGCCTTGTGGGACATAGTGAGG - Intronic
913253337 1:116930810-116930832 GGGCCACGGGGGACACAGGCAGG - Intronic
913487775 1:119349146-119349168 GGGGCTTACGGGTCACAGGTAGG + Intergenic
915722438 1:157994473-157994495 GGGGCTTATTTGACACTGGCAGG + Intronic
915935861 1:160089933-160089955 GGGTCCTATGGGGCACAGCCAGG + Exonic
917427278 1:174928047-174928069 GGGCCTTATAGGGCACAGTAAGG - Intronic
917958529 1:180124734-180124756 GGGCCTCATGGGCCACAGGATGG + Intergenic
919888692 1:201954424-201954446 GGGACTTATGGGGACCAGGCCGG - Intergenic
920032737 1:203047197-203047219 GGGTCTGCTGGGACACAGCCAGG - Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
921398521 1:214694473-214694495 GGGTCTTGTGGGAGCCAGGCTGG - Intergenic
922740158 1:228010038-228010060 TGGCCTCATGGGACGCAGGTGGG - Intronic
923289657 1:232531982-232532004 GGGACTGATGGGCCACAGGAAGG + Intronic
924949028 1:248865855-248865877 GGGGCATATGGGAGACAGGGAGG + Intergenic
1063298094 10:4826421-4826443 GCGCCCGATGGGACCCAGGCCGG + Intronic
1067731810 10:48818029-48818051 GGGCCGTGTGGGACTCAGGTAGG + Intronic
1067837393 10:49650067-49650089 GGCCCTAACGGGACCCAGGCAGG + Intronic
1069039382 10:63679052-63679074 TGACCTTCTGGGACTCAGGCAGG - Intergenic
1070573147 10:77656744-77656766 GGGCCTTAGAGGTCACAGGTGGG + Intergenic
1073626357 10:105101804-105101826 GGGCTTTCTGAGACACTGGCTGG + Intronic
1075122209 10:119672476-119672498 GGATCTTGTGGTACACAGGCTGG - Exonic
1075360246 10:121825749-121825771 TGGCCTTATGGAACACAGGGTGG + Intronic
1076717768 10:132375047-132375069 TGGCCTTATGGGAGACAAGGAGG - Exonic
1076735245 10:132456046-132456068 GGTCCTTATGGAGCACAGGTGGG + Intergenic
1079346752 11:19659367-19659389 GGGCCTTGTGTGACACAGGAAGG + Intronic
1081991680 11:47341309-47341331 GGGCCTCCTGGGACCCTGGCTGG - Intronic
1083276868 11:61601846-61601868 GGGCCATGTAGGACACTGGCTGG + Intergenic
1083948731 11:65941820-65941842 GGGCCTTAGGGCAGACTGGCTGG + Intergenic
1084922144 11:72479822-72479844 GGGCCTTACTGGAAACAGGATGG + Intergenic
1089067409 11:115672385-115672407 GGGCCTTGTGGGACTCAGTGGGG + Intergenic
1089792791 11:120956717-120956739 GGGTGTGAAGGGACACAGGCAGG - Intronic
1090174031 11:124631770-124631792 GGAACTCATGGAACACAGGCAGG - Intronic
1091754122 12:3040722-3040744 GGGCCGTCTGGGAGGCAGGCCGG + Intergenic
1092955420 12:13545000-13545022 GGGCCTTGTAGGACACTGTCAGG - Exonic
1094099325 12:26744189-26744211 GGGCCTTGTGGGCCACAGGGAGG - Intronic
1096111750 12:49033148-49033170 GGGCCTTATGGGACACAGGCTGG - Exonic
1096971965 12:55673936-55673958 GGGCCTTATGGGCTACAGTAAGG + Intergenic
1100432802 12:94545826-94545848 GGGCCTTATAGGCCACAAGAAGG + Intergenic
1103724550 12:122991216-122991238 GGGCGTTTGGGGACAAAGGCAGG + Intronic
1105923340 13:24984928-24984950 GGACCTTGTGGGAGACAGCCTGG + Intergenic
1107440599 13:40424204-40424226 AGGCCTTGAGGGCCACAGGCTGG + Intergenic
1110866998 13:80407421-80407443 GAGATTTATGGGAGACAGGCTGG + Intergenic
1112012944 13:95307463-95307485 GGGTCTTATGTTACCCAGGCTGG + Intergenic
1113082675 13:106535005-106535027 GGGACTGACGGGACGCAGGCTGG + Exonic
1115616822 14:35103188-35103210 GGGCCTTTTGGGCCACAGTAAGG - Intronic
1118158302 14:63263336-63263358 AAGCCTCATAGGACACAGGCTGG + Intronic
1118655267 14:67940555-67940577 GAACCTTATGGGACACAAACAGG - Intronic
1118714345 14:68548551-68548573 GGGCCTGATGGGGCACAGCTTGG - Intronic
1122414143 14:101540777-101540799 GGGCCTCTGGGGCCACAGGCTGG + Intergenic
1123988910 15:25668663-25668685 GGGCCACATGGGGCAGAGGCTGG - Intergenic
1124479759 15:30068221-30068243 GGGCCTGATGGGAAGCAGGGTGG - Intergenic
1127724039 15:61729951-61729973 AGTCTTTATTGGACACAGGCTGG + Intergenic
1129077010 15:73005560-73005582 GAGCCTTGTGGGCCACAGGAAGG + Intergenic
1129661701 15:77556391-77556413 GGGGCTGATGGCACACAGGCTGG - Intergenic
1129763153 15:78143560-78143582 GGGCTTTATGGGGCACTGCCAGG + Intronic
1129824854 15:78628340-78628362 AGGCTTTAGGGAACACAGGCGGG - Intronic
1131623845 15:94097071-94097093 GGGCCTTGTAGGACAGAGGATGG + Intergenic
1132343571 15:101093087-101093109 TGGCCTTGTCGGACACAGCCTGG - Intergenic
1132614011 16:831522-831544 GGCCCTTCGGGGACACAGGCTGG - Intergenic
1132775144 16:1589354-1589376 AGGCCTGATGGGAGACAGCCTGG - Intronic
1133182745 16:4070748-4070770 GGGTCTTATGTTACTCAGGCTGG - Intronic
1133411524 16:5573027-5573049 GGGCCATATGGGGCAGGGGCAGG + Intergenic
1135119444 16:19753021-19753043 GAGCCTTATAGGACATAGGCTGG - Intronic
1135715350 16:24760073-24760095 AGGACTGATGGGAAACAGGCTGG - Intronic
1136655794 16:31708464-31708486 GCTCCTTGTGGGGCACAGGCAGG - Intergenic
1139518100 16:67463803-67463825 GGGCCTTGTGGGACAGGTGCGGG + Intronic
1139631500 16:68234499-68234521 GAGCCTTCTGGGCCTCAGGCAGG - Intronic
1140168260 16:72577014-72577036 GGGCCTCATGGGCCACAGTAGGG + Intergenic
1141646752 16:85371656-85371678 GACCCTTACGGGACACAGGCTGG + Intergenic
1142197663 16:88746184-88746206 GGGCCTTTTGAGACAGAGGATGG + Intronic
1142413986 16:89931433-89931455 AGGCCTCCTGGGACACACGCTGG - Intronic
1144062864 17:11598971-11598993 GAGCCTTAAGGGACGGAGGCGGG + Intronic
1144742331 17:17590982-17591004 GGGCCGGCTGGGAGACAGGCAGG + Intronic
1144748646 17:17633339-17633361 GGCCCTTCAGGGACCCAGGCAGG - Intergenic
1144775956 17:17784687-17784709 GGGCCTCAAGGCACACAGGAGGG + Intronic
1146352975 17:32111461-32111483 GGGCCTCCTGGGCCACGGGCTGG - Intergenic
1147767131 17:42844737-42844759 GGGCCCTATGGGATACAGAGGGG - Exonic
1149052159 17:52318623-52318645 GGGCTTCATGGGATACACGCAGG - Intergenic
1151666703 17:75549454-75549476 GGGCCTAAGGGGACAGAGGAGGG - Intronic
1151821838 17:76500975-76500997 GGCACTTCTGGGACGCAGGCGGG + Intronic
1151870808 17:76835243-76835265 TGTCCCTATGGGACCCAGGCCGG + Intergenic
1152347753 17:79763899-79763921 GGGCCTTATGCGAGGGAGGCAGG + Intergenic
1152848256 17:82615824-82615846 GGGCCTCCTGGGCCACGGGCTGG - Exonic
1153245950 18:3073006-3073028 GGGTCTTATGTTACCCAGGCTGG + Intronic
1154344043 18:13527790-13527812 TGGCCTCCTGGGACTCAGGCAGG - Intronic
1157734372 18:50033629-50033651 GGGCCTTCTGGGTCTCAGACAGG + Intronic
1161062423 19:2221935-2221957 GGGTCTCAGGGGACACAGGATGG - Intronic
1161267879 19:3373367-3373389 GGGCCTTGTGGGCCACAGTGAGG - Intronic
1161271029 19:3389374-3389396 CGGCCTTGTGGGCCACAGACAGG + Intronic
1161277456 19:3426629-3426651 GGGCCTTGTGGGCCACAGGGAGG - Intronic
1161300031 19:3538055-3538077 GGGCCTTGTGGGCCTCAGGGAGG + Intronic
1161997069 19:7719750-7719772 GGGCCTTCTGGAACACTGGTGGG + Intergenic
1162041056 19:7971336-7971358 GGGCCATACTGGACACAGACAGG + Intronic
1163862185 19:19748291-19748313 GGAACTCATGGGACACAGCCTGG + Intergenic
1165358325 19:35317899-35317921 GGGCCTTGTAGGCCACAGGCAGG + Intergenic
1165358339 19:35318005-35318027 GGGCCTTGTAGGCCACAGGCAGG + Intergenic
1166202865 19:41249873-41249895 GGCCCTTATGGGAGACTGGCAGG - Intronic
925034863 2:677192-677214 GGGCCTTCTTGGCCACAGGCCGG + Intronic
925387615 2:3473137-3473159 GGGCCTGCTGGGAACCAGGCAGG - Intronic
926304768 2:11629886-11629908 GGGTCTTCTGGGAAGCAGGCCGG + Intronic
926363613 2:12113186-12113208 GGGCCTTGTGGGCCCCAGTCAGG + Intergenic
932304283 2:70690884-70690906 GGGCATTGTGGGAGACAGGCAGG + Exonic
937976130 2:127583142-127583164 GGGCTTGATGGGACAGAGACCGG + Intronic
938141580 2:128798994-128799016 GGGCCTTCTCTGAGACAGGCTGG + Intergenic
941344298 2:164348418-164348440 GGGCCTTGTGGGAGATGGGCTGG + Intergenic
944391987 2:199227494-199227516 GGGCCTTCTGGGATATTGGCGGG - Intergenic
945044035 2:205766250-205766272 GGCTCTGATGGGACACAGCCAGG - Intronic
947383376 2:229566666-229566688 GAGCCTGATGGGAGAGAGGCTGG - Intronic
948216392 2:236236665-236236687 GGGCATTCAGGGACTCAGGCAGG - Intronic
948518628 2:238522040-238522062 GGGCCGTCTGGGCCAAAGGCAGG - Intergenic
948797300 2:240411648-240411670 GGGCCTCTTGGGCCACAGGGTGG - Intergenic
948995581 2:241576577-241576599 AGGCCTCATGGGAAACAGGGTGG - Intergenic
1168803197 20:657003-657025 AGGCCTTATGGCACAGAGACAGG + Intronic
1169036944 20:2461709-2461731 CAGCCTTACGGGAAACAGGCAGG + Exonic
1170127851 20:12985743-12985765 GGGACTTTGGGGACACAGTCTGG + Intergenic
1172149453 20:32779942-32779964 GGGCCAGAGGGGACAGAGGCTGG + Intronic
1172481356 20:35273750-35273772 GAGCCTTCTGGGAGAGAGGCTGG - Intronic
1174237303 20:49104474-49104496 GAGCTTGATGGGGCACAGGCAGG - Intergenic
1174419786 20:50391906-50391928 GGGCCTTATGAGAGGGAGGCGGG + Intergenic
1175443463 20:59006112-59006134 GGGGCTTTTGGGTGACAGGCAGG - Intronic
1175786963 20:61717963-61717985 GGGCCTTCTGTGGCACAGGCAGG - Exonic
1175883207 20:62272262-62272284 GGGCCTTAGGGGTGCCAGGCAGG + Intronic
1175998925 20:62823543-62823565 CTCCCTTCTGGGACACAGGCTGG - Intronic
1177589667 21:23146060-23146082 GGGTCTTCTGGGACATAGGTAGG + Intergenic
1178749985 21:35293254-35293276 GGACTTTTTGTGACACAGGCAGG + Intronic
1179611786 21:42556658-42556680 GGGGCTCTTGGGACACAGACTGG + Intronic
1179987537 21:44930011-44930033 GGGCCTTGTGGGGCAGAGGCTGG - Intronic
1181655434 22:24294028-24294050 GGGCTTCATGTGACACAGGACGG - Intronic
1181657404 22:24314727-24314749 GAGCCTTATGGGACAGATTCAGG + Intronic
1181709313 22:24671651-24671673 GGGCTTCATGTGACACAGGACGG - Intergenic
1181783348 22:25208454-25208476 TGGCCTAATGGGAAACAGCCAGG + Intergenic
1182460668 22:30481523-30481545 GTGCCTTATTGGACACATCCTGG + Intergenic
1182739090 22:32553883-32553905 GGGCTGTATGGGAGAAAGGCTGG + Intronic
1182775498 22:32828524-32828546 GAGCCTTCTAGGCCACAGGCAGG + Intronic
1182852947 22:33492135-33492157 GGGCCTTGTCGGCCACTGGCAGG + Intronic
950106708 3:10393193-10393215 GGGCCGGAAGGGACACAGCCAGG + Intronic
952258127 3:31713168-31713190 GGGCCTCACGGGCCACAGTCAGG - Intronic
952879382 3:37973957-37973979 GCGCCCTGTGGGTCACAGGCTGG - Intronic
953687144 3:45086908-45086930 GGGCCATATAAGGCACAGGCTGG + Intronic
957571333 3:81950570-81950592 GGGCCTTCTAGGTCACAGGTAGG + Intergenic
959502721 3:107125003-107125025 GGGCCATCTGGAGCACAGGCTGG + Intergenic
960155026 3:114290866-114290888 GGGGGTGATGGGACACAGGGCGG + Intronic
961808576 3:129507317-129507339 GAGCCTGCTGGGACAAAGGCAGG - Intronic
965371577 3:167869128-167869150 GGGCCTTGTAAGACTCAGGCAGG - Intergenic
968628669 4:1639085-1639107 GGGCCCTGTGGGACCCTGGCAGG + Intronic
968663146 4:1807028-1807050 GGGCCTTCTGGGGCACAGCCTGG + Intronic
970120283 4:12745964-12745986 GGGCCTTGGGGGACGCAGGGAGG + Intergenic
971268847 4:25118366-25118388 GGGCCTTTTGGGACACAGCAAGG + Intergenic
971596168 4:28531733-28531755 GGTCCTTATAAGAGACAGGCAGG + Intergenic
972671114 4:41214661-41214683 GGGCCGAATGGGAGAAAGGCGGG + Intronic
973624643 4:52759195-52759217 AGCCATTATGGGACACAGGCTGG - Intergenic
978683714 4:111414681-111414703 GGGACCTGTGGGAGACAGGCTGG + Intergenic
983650233 4:170029684-170029706 GGATATTAGGGGACACAGGCTGG - Intronic
988128511 5:27073778-27073800 GGGACTTATGGGAGACGGACTGG - Intronic
991437844 5:66614782-66614804 GGACCTCACGGGACACATGCAGG + Intronic
992847395 5:80764936-80764958 GGGCCTCACTGGACACAGGATGG - Intronic
994449809 5:99928566-99928588 GGGAGTTGTGGGACCCAGGCTGG - Intergenic
994724379 5:103416950-103416972 GGACCTTATGAGAAACAGGCAGG - Intergenic
995877977 5:116811212-116811234 GGGCTTTGTGCGACACAGTCAGG + Intergenic
996066346 5:119083731-119083753 GGGTTTTATGTGAGACAGGCTGG + Intronic
996472757 5:123879208-123879230 GGGTATTTTGGGCCACAGGCAGG + Intergenic
997269743 5:132526605-132526627 GGGCCTTGGGGGACCCAGACGGG + Intergenic
1001152968 5:169248141-169248163 GGGCCTTAAGGAGCACAGGGAGG - Intronic
1001309550 5:170601213-170601235 GGAGCTAATGGGACACATGCCGG + Intronic
1002457306 5:179352827-179352849 GGGCCTTGTGGGTCTCAGCCAGG + Intergenic
1004682011 6:17905040-17905062 GGGCCTCATGGGGCCCAGGACGG + Intronic
1005109748 6:22267565-22267587 GGGCCTTGGGGGACAGAGCCAGG - Intergenic
1005831233 6:29672730-29672752 GGGCCTTATGGATCACTGGAGGG - Exonic
1007729006 6:43934552-43934574 GGTCCTTCTGGCTCACAGGCTGG + Intergenic
1008311957 6:49987792-49987814 GGGACTTAAGGTACAGAGGCAGG - Intergenic
1011027624 6:82886467-82886489 GTTCCTAATAGGACACAGGCTGG + Intergenic
1011647024 6:89469482-89469504 GGGGCTTATGGTAAAAAGGCTGG - Intronic
1018199254 6:161380007-161380029 GGGCCTTATCAGCCACAGGCAGG - Intronic
1019607585 7:1917925-1917947 GGGCCTGATGCAACACAGTCAGG - Intronic
1019626647 7:2019247-2019269 GGCCCTGCTGGGACAGAGGCTGG + Intronic
1023241289 7:38150884-38150906 GGGACCCATGGGAGACAGGCTGG - Intergenic
1027600008 7:80228294-80228316 GGTCCTTATAGGAAAGAGGCAGG - Intergenic
1030111479 7:106030521-106030543 GGGTGTTATGGGGCACAGGTAGG - Intronic
1032270186 7:130398124-130398146 GGGCTTCAAGGGGCACAGGCCGG + Exonic
1032520798 7:132543312-132543334 GGGCATTACAGGACACAAGCTGG - Intronic
1036081083 8:5556352-5556374 GGGCCTTAAAGGACACAGATTGG - Intergenic
1036123111 8:6039224-6039246 TGGCCTTATCAGACAGAGGCAGG - Intergenic
1036296713 8:7543438-7543460 GGGACTTCCTGGACACAGGCGGG - Intergenic
1036325854 8:7777581-7777603 GGGACTTCCTGGACACAGGCGGG + Intergenic
1039792651 8:40887967-40887989 GGGCCTCATGGGAGGCAGGAGGG - Intronic
1041012803 8:53560249-53560271 GGGACTTCTGGGAGACAGACTGG - Intergenic
1041256794 8:55985773-55985795 GGGGCTTGTGGCATACAGGCAGG + Intronic
1045546411 8:103133049-103133071 GGGCCTTGGTGCACACAGGCAGG - Exonic
1046221903 8:111227682-111227704 GGGACTTCCGGGTCACAGGCAGG - Intergenic
1049451670 8:142665290-142665312 GGGCCTTATAGGCGACGGGCAGG + Exonic
1049576381 8:143391787-143391809 GGGCCAGGTGGGGCACAGGCAGG - Intergenic
1049923791 9:389688-389710 GGGCCTGATGAAACACAGACTGG - Intronic
1052786500 9:32832987-32833009 TGCCCTCAAGGGACACAGGCAGG - Intergenic
1055214438 9:73841079-73841101 GGGGCTTATGGGGCATAGGAGGG + Intergenic
1056739331 9:89240298-89240320 GTGCCATTTGGGAGACAGGCTGG - Intergenic
1058136005 9:101308232-101308254 GGTCCTTATAAGAGACAGGCAGG + Intronic
1059424702 9:114213438-114213460 TGGCCTTATCTCACACAGGCAGG - Intronic
1061059839 9:128244908-128244930 GGGGCTAGGGGGACACAGGCTGG - Intronic
1061819806 9:133220814-133220836 GGCCCTTATAGGAGAGAGGCTGG + Intergenic
1062240850 9:135537134-135537156 GGCCCTTATAGGAGAGAGGCTGG - Intergenic
1062354823 9:136156964-136156986 CGGCCTCCTGGGACACAGGGAGG - Intergenic
1062376217 9:136263033-136263055 GGATCTCATGGGACCCAGGCAGG - Intergenic
1062424901 9:136501682-136501704 GGGGCTTAGGGGAGAGAGGCAGG + Intronic
1062568750 9:137174845-137174867 GTGCATTCTGGGACACGGGCGGG + Exonic
1186512836 X:10143296-10143318 GATCCTTGTGGGGCACAGGCTGG - Exonic
1187425084 X:19170465-19170487 GGGCATTGTGGGAGACAGGCTGG - Intergenic
1197275761 X:124477159-124477181 TTTCCTTAAGGGACACAGGCAGG - Intronic
1199948219 X:152683934-152683956 GGGCCTCATGTCACACAGGGTGG - Intergenic
1199961460 X:152784520-152784542 GGGCCTCATGTCACACAGGGTGG + Intergenic
1202126518 Y:21573443-21573465 GGCCCTTATGGTACACTGGGAGG + Intergenic