ID: 1096111763

View in Genome Browser
Species Human (GRCh38)
Location 12:49033184-49033206
Sequence GGTGCTCAGTTCCCCCCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 144}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096111763_1096111770 9 Left 1096111763 12:49033184-49033206 CCAGCTGGGGGGAACTGAGCACC 0: 1
1: 0
2: 0
3: 17
4: 144
Right 1096111770 12:49033216-49033238 GTCATAAGCACCTGTCTGTGAGG 0: 1
1: 0
2: 0
3: 8
4: 119
1096111763_1096111772 16 Left 1096111763 12:49033184-49033206 CCAGCTGGGGGGAACTGAGCACC 0: 1
1: 0
2: 0
3: 17
4: 144
Right 1096111772 12:49033223-49033245 GCACCTGTCTGTGAGGGCCCTGG 0: 1
1: 0
2: 2
3: 20
4: 245
1096111763_1096111771 10 Left 1096111763 12:49033184-49033206 CCAGCTGGGGGGAACTGAGCACC 0: 1
1: 0
2: 0
3: 17
4: 144
Right 1096111771 12:49033217-49033239 TCATAAGCACCTGTCTGTGAGGG 0: 1
1: 0
2: 1
3: 11
4: 107
1096111763_1096111774 18 Left 1096111763 12:49033184-49033206 CCAGCTGGGGGGAACTGAGCACC 0: 1
1: 0
2: 0
3: 17
4: 144
Right 1096111774 12:49033225-49033247 ACCTGTCTGTGAGGGCCCTGGGG 0: 1
1: 1
2: 2
3: 20
4: 248
1096111763_1096111776 19 Left 1096111763 12:49033184-49033206 CCAGCTGGGGGGAACTGAGCACC 0: 1
1: 0
2: 0
3: 17
4: 144
Right 1096111776 12:49033226-49033248 CCTGTCTGTGAGGGCCCTGGGGG 0: 1
1: 0
2: 4
3: 27
4: 384
1096111763_1096111773 17 Left 1096111763 12:49033184-49033206 CCAGCTGGGGGGAACTGAGCACC 0: 1
1: 0
2: 0
3: 17
4: 144
Right 1096111773 12:49033224-49033246 CACCTGTCTGTGAGGGCCCTGGG 0: 1
1: 0
2: 2
3: 18
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096111763 Original CRISPR GGTGCTCAGTTCCCCCCAGC TGG (reversed) Exonic
900136556 1:1120088-1120110 GTTGTTCAGGTCCCCCCAGATGG - Intergenic
901435487 1:9245021-9245043 GGTCCCCAGTTGCTCCCAGCAGG - Exonic
901559269 1:10057204-10057226 GGTCCTTAGTTCTCACCAGCTGG + Intronic
902086366 1:13866033-13866055 GAGCCTCAGTTCCCTCCAGCTGG + Intergenic
902350017 1:15847601-15847623 GAAGCTGAGTTCCTCCCAGCCGG - Intergenic
911093258 1:94034722-94034744 TGAGCTCAGTTCCCCCCAGATGG + Intronic
913259176 1:116982933-116982955 GGTGGCCAGTCCACCCCAGCTGG - Intronic
915282155 1:154829883-154829905 GGTGCTCTGGTCACCCCAGCTGG - Intronic
915339199 1:155167077-155167099 GGGGCTCAGTTCCACCCCGGAGG - Intergenic
920386993 1:205576300-205576322 GGTGCTCACTGCCTCCCTGCTGG - Intronic
921177410 1:212607173-212607195 AGTCCCCAGTTCCCCCCACCGGG - Intronic
922575156 1:226656238-226656260 GGCGCTCAGAGACCCCCAGCAGG + Intronic
922857843 1:228790356-228790378 GCTGCTCAGCTCCTCTCAGCAGG - Intergenic
1068756615 10:60661790-60661812 GGTGCTCAGGGCCTCCCAGTGGG - Intronic
1069815455 10:71191118-71191140 GATGCTGAGTTCCATCCAGCAGG - Intergenic
1070792305 10:79196698-79196720 GGAGCTTAGATCCACCCAGCTGG - Intronic
1071966408 10:90857447-90857469 GTTGATCTGTTCCCCACAGCCGG + Exonic
1073115522 10:101089608-101089630 GGTGCCCAGGTCACCTCAGCTGG - Exonic
1075071163 10:119320809-119320831 CGTGCTCAGGTCCCAGCAGCAGG - Intronic
1078088511 11:8249078-8249100 GCTGCTCAGCTCCCCGTAGCAGG - Intronic
1078577665 11:12515703-12515725 GTTGCTCAGCTCCCACCAGAAGG + Intronic
1079488667 11:20962980-20963002 GGTTCTCTGTGCCTCCCAGCCGG - Intronic
1083399478 11:62413885-62413907 GGTGCTCACGTCATCCCAGCTGG + Intronic
1085731259 11:79001358-79001380 GGTGCTCAGTAGCCCCATGCAGG - Intronic
1088585083 11:111354521-111354543 GGTGCTCTGGGCCCTCCAGCGGG + Exonic
1089292129 11:117443755-117443777 GGTGGCCAGTTCCTCACAGCTGG + Intronic
1090231805 11:125112196-125112218 CGTCCTCAGTTCCCTCCAGGAGG - Intergenic
1090623418 11:128583301-128583323 GCTACTCAATTCTCCCCAGCCGG - Intronic
1090997241 11:131877852-131877874 GGTGCTCAGCTCCCTCCAGGTGG + Intronic
1091110817 11:132964711-132964733 GGTCCTCTGATCCCCTCAGCAGG + Intronic
1091485163 12:879660-879682 GGTGCTCATTTCCTTCCAGTGGG + Exonic
1093176428 12:15918206-15918228 GGTGCTTGGTCCCCCACAGCAGG + Intronic
1094689484 12:32755133-32755155 GTTGATCAGATCCGCCCAGCTGG + Exonic
1096111763 12:49033184-49033206 GGTGCTCAGTTCCCCCCAGCTGG - Exonic
1096461577 12:51824318-51824340 GCTTCTCAGTTCTCCACAGCTGG + Intergenic
1100186428 12:92145175-92145197 GGCGCCCCCTTCCCCCCAGCTGG - Intronic
1104736739 12:131139775-131139797 AGTGGTGAGTTCCCCACAGCCGG + Exonic
1104904369 12:132205504-132205526 GCTGCTCAGCTCAGCCCAGCCGG + Intronic
1105417697 13:20227548-20227570 GGTGCTCAGTGACCCTGAGCTGG + Intronic
1109207758 13:59500787-59500809 GTTGCTCAGGTGCCTCCAGCTGG - Intergenic
1112738791 13:102451037-102451059 GATGCACAGTTCACCACAGCTGG - Intergenic
1113791646 13:113032172-113032194 GGTGCTCAGGTCACCGCAGGGGG - Intronic
1121412998 14:93760702-93760724 GGTGCTCAGTACACACTAGCTGG + Intronic
1122072950 14:99216557-99216579 GGGGCTCAGTCTCCCCCAGGAGG + Intronic
1122290807 14:100679517-100679539 GGGCCTCAGTTTCCCCAAGCTGG - Intergenic
1124167184 15:27338616-27338638 GGTGCTCAGTGCCCCCAGGGAGG + Intronic
1124371414 15:29106722-29106744 GATGCTCAGCTTCCCCGAGCGGG - Exonic
1128354928 15:66919414-66919436 TGTGCTCTGTTCCATCCAGCTGG - Intergenic
1130108398 15:80945799-80945821 GGTGCTCACTTCCTCCTATCTGG + Intronic
1131161080 15:90105246-90105268 GGGGCTCAGATCCTCCCATCTGG + Intergenic
1132568097 16:632285-632307 AGTGCTCAGGACCACCCAGCAGG - Intronic
1132835501 16:1950998-1951020 GGTGCTCAGAAGCCCCCAACCGG + Intronic
1132948597 16:2547204-2547226 GCTGCTCATTTCCCCCCATGTGG + Intronic
1133225188 16:4337507-4337529 TGGGCTCAGTTCACCACAGCCGG - Exonic
1133688877 16:8194057-8194079 GGTCCTCACTTCTCCCCATCAGG + Intergenic
1134672241 16:16064427-16064449 GGTGCTCAGTTACCACCTGAGGG + Intronic
1135673231 16:24392516-24392538 CGTCCTCAGTTTCCCCCACCTGG + Intergenic
1136142266 16:28295043-28295065 GGAGTTCATTTCCCCCCAGTGGG + Intronic
1138431728 16:56973182-56973204 TGTACCCAGTTTCCCCCAGCGGG - Intronic
1140932183 16:79637930-79637952 GGTGTTCACTTCCACCCAGGAGG + Intergenic
1141156139 16:81598400-81598422 GGTGCTCAGTGGCCCACAGGTGG + Intronic
1141678338 16:85529527-85529549 GCTGCTCAGCTGCCCCCAACAGG - Intergenic
1141878117 16:86840300-86840322 GCTGCTCTGGTCCTCCCAGCTGG + Intergenic
1141889202 16:86915341-86915363 GGCGCTCAGGTCCTCGCAGCTGG - Intergenic
1143924218 17:10355599-10355621 GGTGCCCAGTGCTCCCAAGCTGG + Intronic
1146448748 17:32954774-32954796 GGGGCTGAGTGCCGCCCAGCTGG + Intergenic
1148871565 17:50661514-50661536 GGTGCTCTGTCCCCACCATCAGG + Intronic
1149622968 17:58060040-58060062 GGTTCTCTGTTCTTCCCAGCTGG + Intergenic
1151542639 17:74772524-74772546 GGTCCTCAGTTTCCCCCAAGTGG - Intronic
1151933251 17:77246738-77246760 GCTCCTCACTTCCCCCCTGCAGG - Intergenic
1151936209 17:77263250-77263272 TGTGCTCAGTTGCCCTCAGCTGG - Intergenic
1152038839 17:77890379-77890401 GGTGCTTAGTGTCCCCCACCAGG + Intergenic
1152091699 17:78250952-78250974 GGGGCCCAGTGCCCCCCAGCTGG - Intergenic
1152379560 17:79935288-79935310 GGACCTCAGGCCCCCCCAGCAGG - Exonic
1153986408 18:10354728-10354750 AGTGCTCAGTACCCCCCTACAGG + Intergenic
1160843869 19:1158198-1158220 GGTGCTCAGGGACCCCCAGGGGG - Intronic
1164271054 19:23672040-23672062 GGTTCTCAGTGCCCCTGAGCTGG + Intronic
1165735852 19:38175122-38175144 GGGCCTCAGTTTCCCCCACCTGG + Intronic
1166667399 19:44689345-44689367 GGTGCTCTGCTGCCCCCTGCTGG - Intergenic
1166830757 19:45638458-45638480 GGTGCTCCCATCCCCCCAGGAGG - Intronic
1168215306 19:54920790-54920812 GGTGCTGTGTTGCCCACAGCCGG - Intergenic
925201137 2:1968578-1968600 GGAGCTCAGTTTCCCTCAGCAGG + Intronic
925599969 2:5598286-5598308 AGTGCTCAGATTTCCCCAGCAGG + Intergenic
928867840 2:35939021-35939043 AGTGCTCAGTACTCCCTAGCGGG - Intergenic
929867991 2:45734698-45734720 GATGCGCAGATCCCCCCTGCAGG + Intronic
937323217 2:120973327-120973349 GGTGCTCAGTGCCTGCCTGCCGG - Intronic
937391312 2:121489414-121489436 TGTGCCCAATTCCCCACAGCAGG + Intronic
945134779 2:206615584-206615606 GGAGCTCACTTTCCCCCTGCTGG + Intronic
946110732 2:217413019-217413041 GTTCCTCAGTTAGCCCCAGCTGG - Intronic
947759411 2:232592872-232592894 GGTCATCAGTCCCCACCAGCAGG - Intergenic
947871018 2:233438057-233438079 AGTGAACAGTTCCCCACAGCCGG - Intronic
948588532 2:239035763-239035785 GGTGTCCAGTCCCCTCCAGCAGG - Intergenic
1169253947 20:4083190-4083212 GGTGCTCCGTTACCACCAGCTGG + Intergenic
1171333857 20:24365403-24365425 TGTGGTCAGTTCCCCCCAATAGG - Intergenic
1175065718 20:56285922-56285944 GGTGTTCAGTTCCCACCACCAGG + Intergenic
1176025164 20:62981995-62982017 CCTGCTCACTGCCCCCCAGCAGG - Intergenic
1176216389 20:63949955-63949977 GGTGCTCAGTCCTCTCCAGCAGG + Intronic
1179563494 21:42232033-42232055 GGTTCTCAGTGGCCCCCAGGTGG + Intronic
1184675680 22:46041711-46041733 GGTGCCCAGCTCCCACCTGCAGG - Intergenic
1185122036 22:48977137-48977159 TGTGCCCTGTTCCCTCCAGCAGG + Intergenic
950114129 3:10439389-10439411 GGTGCTCAGTCCACCCATGCTGG - Intronic
950131065 3:10547043-10547065 GCTGCTCAGTTCCCGGCTGCTGG - Intronic
950546197 3:13639439-13639461 GGTGCACAGTCCCCACCAGCGGG + Intergenic
950679102 3:14572844-14572866 GATGCTCAGCTCCACCGAGCTGG - Intergenic
950846870 3:16023359-16023381 GAGGTTCAGTTCCCCCCAGTAGG + Intergenic
952902776 3:38120935-38120957 GGTGCTCTGTCCCACCCATCAGG - Intronic
954073224 3:48158289-48158311 GGTGCTCTGTCACCCCCAGGAGG - Exonic
961617493 3:128194268-128194290 GGAGCTCAGCACCCTCCAGCTGG - Intronic
966846503 3:184134881-184134903 GGTTCTGAGTTCCTCGCAGCGGG + Intergenic
968894414 4:3390297-3390319 GGTGCTTTTGTCCCCCCAGCTGG + Intronic
969212060 4:5695558-5695580 GGGCCTCAGTTCCCCTCACCTGG + Intronic
972468692 4:39383678-39383700 GGTGGTGAGTTCCCCCAGGCAGG + Intergenic
976272912 4:83248471-83248493 GCTGCTCATTTCCCTCCATCAGG - Intergenic
978435060 4:108675082-108675104 GCTGATCAGTTCCCCTCAGCTGG + Intergenic
988734635 5:34008035-34008057 GCTGCTCAGTTTCCTTCAGCGGG - Intronic
990217846 5:53553544-53553566 CTTGCTCAGTACCCTCCAGCGGG - Intergenic
991221644 5:64225565-64225587 GGCGCTCACTTCCTCCCAGACGG - Intronic
991444121 5:66681484-66681506 GGTGCTGAGTCACCCCCACCAGG - Intronic
992388425 5:76308343-76308365 GGAGCTCATTACCACCCAGCAGG + Intronic
994932439 5:106206298-106206320 GGTGCTAAGCCCCTCCCAGCGGG + Intergenic
1001074200 5:168613188-168613210 GGTGCTCAGTGCACCACATCAGG - Intergenic
1001402136 5:171451740-171451762 GGTGCTCAGTGCCACGCATCTGG - Intronic
1001941634 5:175743862-175743884 GGTACTGAGATCCCCCCAGAGGG + Intergenic
1003052106 6:2789273-2789295 GCTGCTCAGTGCCCCGCTGCTGG - Intergenic
1003120199 6:3313053-3313075 AGTGCTCACTTCCCCCTTGCAGG + Intronic
1005990153 6:30897514-30897536 GTTCCTCAGTGCCCACCAGCTGG + Exonic
1006900278 6:37495912-37495934 GCTTCTCAGTTGCCCCCAGCGGG - Intronic
1007126654 6:39431418-39431440 GGTTTTCATTTCCCCCGAGCAGG - Intronic
1013547090 6:111169031-111169053 GGTCCTCTGTTCCCCACAACTGG - Intronic
1013585673 6:111576487-111576509 GGTGCTGAGTTTTCCCCAGAAGG + Intronic
1016388261 6:143549553-143549575 GCTGCTGAGTACCCCCCAGCAGG - Intronic
1017600028 6:156070148-156070170 GGTTCTCTGATCGCCCCAGCTGG + Intergenic
1019288157 7:234040-234062 GCTGCTCAGTGCCCCCCTGGGGG + Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1020257366 7:6509571-6509593 GGTGTTCAGTGGCTCCCAGCTGG - Intronic
1020682138 7:11250409-11250431 GGTGCTCTGTCAGCCCCAGCTGG + Intergenic
1022855981 7:34315047-34315069 GGTTCTCATCTCTCCCCAGCTGG - Intergenic
1022860676 7:34363422-34363444 GGCTCTCAGTTCCCCCCACCTGG - Intergenic
1024637991 7:51306215-51306237 CGTGCTCAGTTCATCCCTGCTGG + Intronic
1030156911 7:106464908-106464930 GGAGCTCAGTTCTCATCAGCTGG + Intergenic
1031752248 7:125591108-125591130 GGGGCTCAGTAGCCCACAGCTGG - Intergenic
1037330775 8:17741632-17741654 GGCGATCAGTCCCACCCAGCGGG - Intronic
1040945524 8:52881143-52881165 GCCTCTCAGTTTCCCCCAGCTGG + Intergenic
1049619954 8:143593580-143593602 GGTGCCCAGTTCCTCCCTGCAGG - Intronic
1049644534 8:143730135-143730157 GATGATCCGTTCCGCCCAGCAGG - Exonic
1049671230 8:143870817-143870839 GGTGGACAGTGCCACCCAGCAGG - Exonic
1051653856 9:19358905-19358927 GGTGGTATGTTCCTCCCAGCAGG + Intronic
1051770245 9:20569948-20569970 GCTCCTCATTTGCCCCCAGCTGG + Intronic
1053066367 9:35072151-35072173 GGTGCGCAGCTGGCCCCAGCCGG + Intronic
1054700495 9:68408092-68408114 GGTGGACATTTCCCCCCAGATGG + Intronic
1056216278 9:84408638-84408660 GGTGCGCAGGGTCCCCCAGCAGG + Intergenic
1057216225 9:93230336-93230358 GGGCCTCAGTGCCCCTCAGCCGG + Intronic
1060061593 9:120465460-120465482 GGTGCTCAGTTCCTGCCTGTTGG - Intronic
1060604212 9:124899607-124899629 GTTGCTGAGGTCCCCCCTGCAGG + Intronic
1062599460 9:137313392-137313414 GGAGCTCAGGTCCCACCACCAGG + Intronic
1062697286 9:137881885-137881907 GCTGCTCTGTTCCCTCCACCTGG + Intronic
1190690429 X:52908912-52908934 GCTGCTCAGTTTCACCCACCCGG - Intergenic
1190695554 X:52946880-52946902 GCTGCTCAGTTTCACCCACCCGG + Intronic
1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG + Intronic
1190918342 X:54826525-54826547 GGTGCTCAGTGAGCCCCAGCGGG - Intergenic
1191671499 X:63752544-63752566 GGTTCTCAGTTCCATCCAGGGGG + Intronic
1195710014 X:107766245-107766267 GGGGCTCAGTTCCACTAAGCCGG + Intronic