ID: 1096112388

View in Genome Browser
Species Human (GRCh38)
Location 12:49037308-49037330
Sequence CCATAGCCATGGATGGAGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 166}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096112377_1096112388 18 Left 1096112377 12:49037267-49037289 CCCTCCATGCTGCCCACTTAGCA 0: 1
1: 0
2: 3
3: 18
4: 191
Right 1096112388 12:49037308-49037330 CCATAGCCATGGATGGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 166
1096112380_1096112388 6 Left 1096112380 12:49037279-49037301 CCCACTTAGCATATGCCCTTGAT 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1096112388 12:49037308-49037330 CCATAGCCATGGATGGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 166
1096112384_1096112388 -10 Left 1096112384 12:49037295-49037317 CCTTGATTGGACACCATAGCCAT 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1096112388 12:49037308-49037330 CCATAGCCATGGATGGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 166
1096112383_1096112388 -9 Left 1096112383 12:49037294-49037316 CCCTTGATTGGACACCATAGCCA 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1096112388 12:49037308-49037330 CCATAGCCATGGATGGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 166
1096112381_1096112388 5 Left 1096112381 12:49037280-49037302 CCACTTAGCATATGCCCTTGATT 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1096112388 12:49037308-49037330 CCATAGCCATGGATGGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 166
1096112376_1096112388 22 Left 1096112376 12:49037263-49037285 CCTGCCCTCCATGCTGCCCACTT 0: 1
1: 0
2: 1
3: 41
4: 404
Right 1096112388 12:49037308-49037330 CCATAGCCATGGATGGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 166
1096112378_1096112388 17 Left 1096112378 12:49037268-49037290 CCTCCATGCTGCCCACTTAGCAT 0: 1
1: 0
2: 1
3: 9
4: 155
Right 1096112388 12:49037308-49037330 CCATAGCCATGGATGGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 166
1096112379_1096112388 14 Left 1096112379 12:49037271-49037293 CCATGCTGCCCACTTAGCATATG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1096112388 12:49037308-49037330 CCATAGCCATGGATGGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 166
1096112375_1096112388 26 Left 1096112375 12:49037259-49037281 CCTGCCTGCCCTCCATGCTGCCC 0: 1
1: 0
2: 13
3: 90
4: 936
Right 1096112388 12:49037308-49037330 CCATAGCCATGGATGGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096112388 Original CRISPR CCATAGCCATGGATGGAGCC AGG Exonic
900406651 1:2495801-2495823 CCACAGCCCTGGATGCTGCCGGG + Intronic
900529464 1:3145544-3145566 CCAGAGCCCTGGATGCAGCTGGG - Intronic
900811427 1:4804295-4804317 CCATACTCATGTGTGGAGCCTGG + Intergenic
902620375 1:17647237-17647259 CCCTAGCCATGGCTGTGGCCTGG + Intronic
904626964 1:31811828-31811850 CCGCAGTCAAGGATGGAGCCTGG + Intronic
905046836 1:35010885-35010907 GCAGAGCCACGGATGGAGCTGGG + Exonic
907306080 1:53513855-53513877 CCATGGCCAAGGCTGTAGCCAGG + Intronic
913322696 1:117600264-117600286 ACAGAGCCAGGGATGGATCCCGG + Intergenic
920035947 1:203065483-203065505 CCATAGTCCTGGCTGGGGCCAGG - Intronic
920919373 1:210285714-210285736 CCATAGCCATAGCTGGATTCAGG - Intergenic
921907297 1:220508680-220508702 CCATAGCCCATGATGGAGCCTGG - Intergenic
922678815 1:227572716-227572738 CACTAGCCATGGAAAGAGCCTGG + Intronic
924218921 1:241853710-241853732 CCATAGCAATGGAAGGAACAGGG + Intronic
1065318358 10:24486072-24486094 CGAGAGCAATGGCTGGAGCCAGG - Intronic
1070154184 10:73823604-73823626 CCAGAGCCATGGATGGTATCTGG + Intronic
1070393163 10:75988803-75988825 CCACTGGCATGGAGGGAGCCAGG - Intronic
1071280724 10:84100323-84100345 CAAGAGCCATGGATTTAGCCTGG - Intergenic
1073434839 10:103510147-103510169 CCAAGGCCAGGGCTGGAGCCTGG - Intronic
1073847446 10:107573895-107573917 CCATGGACATGGATGGAGGAGGG + Intergenic
1075642960 10:124078211-124078233 CCTGAGCCAAGGAGGGAGCCCGG + Intronic
1076658088 10:132037458-132037480 CCGTTGTCATGGAGGGAGCCAGG + Intergenic
1077364262 11:2155202-2155224 CCCTTGCCAGGGATGGAGACCGG - Intronic
1077463157 11:2720994-2721016 CCAGAGCCATGGACGGTCCCTGG + Intronic
1077993054 11:7429184-7429206 CCAGAGACAAGGATGGAGCCAGG - Intronic
1079284635 11:19117506-19117528 CCCTGGCCAGGGATGGAGGCTGG - Intronic
1079386900 11:19988648-19988670 CCAAGGCCCTGGATGCAGCCTGG - Intronic
1082760013 11:57118407-57118429 CCAGAGACATGGATGGAGCTGGG + Intergenic
1084448465 11:69218085-69218107 AAAGAGCCATGGATGGAGTCTGG - Intergenic
1085971213 11:81593123-81593145 CTTTAGGCATGGATGGATCCAGG + Intergenic
1088517458 11:110653912-110653934 GCATGGACATGGATGGAGCTGGG + Intronic
1088573908 11:111251158-111251180 AAATTGCCCTGGATGGAGCCTGG + Intergenic
1089156578 11:116407310-116407332 ACAAAGCCATGGATGGAGACAGG - Intergenic
1089238905 11:117057538-117057560 CCATGGCCTAGGACGGAGCCTGG - Intronic
1091037113 11:132244217-132244239 CCACAGCCAGGGCTAGAGCCTGG - Intronic
1095742348 12:45621192-45621214 CCATTGCCATAGAGGGAGCCTGG + Intergenic
1096112388 12:49037308-49037330 CCATAGCCATGGATGGAGCCAGG + Exonic
1096649068 12:53053104-53053126 CCATGGCCAGGGATGGACACTGG - Intronic
1098700607 12:73620770-73620792 CCATACCCATGGTTACAGCCCGG - Intergenic
1099165651 12:79304150-79304172 CCATAGACATGGTTGCTGCCTGG - Intronic
1100590394 12:96022775-96022797 CCATTGCCAGGGATGGTGCTGGG - Intronic
1101203269 12:102459280-102459302 ACATAGCCATGAATGGTCCCTGG + Intronic
1103181816 12:118919109-118919131 TCATAGCCATGGAAGAAGCATGG + Intergenic
1103195844 12:119043236-119043258 GCAGGGCCATGGATGGAGCTGGG + Intronic
1104276469 12:127333229-127333251 CCAGGGTCATGGATGGGGCCTGG + Intergenic
1108092521 13:46864110-46864132 GCAGGGACATGGATGGAGCCTGG + Intronic
1110404103 13:75129511-75129533 GCATAGCCATGGCAGGAGCAGGG + Intergenic
1112893402 13:104267298-104267320 CCATCACCATGGATGTAGCTAGG - Intergenic
1113614264 13:111669939-111669961 CCATAGCCATGGCGGGGGGCGGG - Intronic
1113619732 13:111754853-111754875 CCATAGCCATGGCGGGGGGCGGG - Intergenic
1115035614 14:28853231-28853253 CCATAACCATGGATAGAGACAGG + Intergenic
1115289277 14:31751984-31752006 TTTTAGCCATGGCTGGAGCCTGG + Intronic
1116326851 14:43540989-43541011 CCAGAGCCAAAGCTGGAGCCCGG + Intergenic
1116510952 14:45746190-45746212 ACTTAGCCAGGGATGGTGCCGGG - Intergenic
1116693662 14:48144427-48144449 ACATAGCCATGCATGGAGTAAGG + Intergenic
1120540346 14:85742922-85742944 CCACAGTCATGGATGGATACAGG + Intergenic
1121765317 14:96480885-96480907 TCACAGCCAGGGATGCAGCCCGG + Intronic
1122070049 14:99200390-99200412 CAATATCTATGGCTGGAGCCAGG + Intronic
1122183830 14:99974332-99974354 TAATAGCCATAGCTGGAGCCTGG + Intronic
1122804138 14:104248141-104248163 CCACAGCCTTGGGTGGAGACAGG - Intergenic
1122826254 14:104372278-104372300 CCTTTGCCATGGATGGGCCCAGG - Intergenic
1124456748 15:29850107-29850129 CTCTAGCCTTGGATGGACCCTGG + Intronic
1126871153 15:52989500-52989522 GCAGAGACATGGATGGAGCTGGG - Intergenic
1128072366 15:64805944-64805966 CCTTAGCCAGGGCAGGAGCCTGG + Intergenic
1129891538 15:79075011-79075033 CCAAGTGCATGGATGGAGCCTGG + Intronic
1130730627 15:86488422-86488444 ATCTAGCCATGGATTGAGCCAGG + Intronic
1137700413 16:50493921-50493943 CAGAAGCCAGGGATGGAGCCTGG + Intergenic
1137796902 16:51229064-51229086 CCAAAGACAGGGATGGAGCGGGG + Intergenic
1140571336 16:76109778-76109800 CCATAGCCCTGGATGATACCTGG + Intergenic
1142231040 16:88900432-88900454 GCAGAGCCAGGGAGGGAGCCAGG + Intronic
1143741443 17:8956944-8956966 CCATAGCCATTCATGGATACTGG - Intronic
1144708627 17:17386062-17386084 CCACAGCCAAGGGAGGAGCCTGG + Intergenic
1146689778 17:34865388-34865410 ACATAGCCATGACTGGAGGCTGG - Intergenic
1147322560 17:39654971-39654993 CCATGGCCATGGATGGCCCTAGG + Intronic
1147746103 17:42695637-42695659 TCATAGCCCGGGATGTAGCCAGG - Exonic
1148107694 17:45128141-45128163 CCACACCCAGGGCTGGAGCCTGG + Intronic
1148694106 17:49548850-49548872 ACAGAGCCATGGGTGCAGCCTGG + Intergenic
1150375339 17:64676714-64676736 GCATCTCCAGGGATGGAGCCTGG + Intergenic
1150441619 17:65196310-65196332 CCATAGACATGAATTGTGCCTGG + Intronic
1152898728 17:82928165-82928187 CCATAGCCATGGCGTGAGCTGGG + Intronic
1155110792 18:22712466-22712488 GCAGAGCCCTGGAGGGAGCCAGG + Intergenic
1155957700 18:31967528-31967550 TCACAGCCATGGTAGGAGCCCGG - Intergenic
1157555306 18:48609686-48609708 CCATATCCCTGGCTGGAGTCAGG - Intronic
1158250236 18:55479684-55479706 CCTGAGCCATGGAAGAAGCCAGG + Intronic
1160726662 19:620652-620674 CCATAGCCACGGATGGAGGATGG + Intronic
1161842532 19:6691556-6691578 TCCTATCAATGGATGGAGCCTGG + Intronic
1163066267 19:14798474-14798496 CCACAGCCATGGAAGAAGACTGG + Intronic
1163714121 19:18864186-18864208 CCACAGCCATGTATGATGCCCGG + Exonic
1164130218 19:22354978-22355000 CCATAGCCATGCATGGTTCCTGG + Intergenic
1164589353 19:29497821-29497843 CCAGAGCCCTGAATGGTGCCAGG - Intergenic
1165230080 19:34381330-34381352 CCAGAGCCAGGGATGGGGCAGGG - Intronic
1166133069 19:40758348-40758370 CCAGAGCCTTGAATGGCGCCTGG + Intronic
1167937024 19:52917608-52917630 ACACAGACATGGATGGAGACGGG - Intergenic
927665835 2:25032178-25032200 CCAGACCCATGGAAGAAGCCTGG - Intergenic
927916014 2:26936535-26936557 CCATAGCCTTGGTGGGTGCCAGG + Intronic
927916375 2:26939116-26939138 CCACAGCCTTGGATGGAGGATGG + Intronic
929343901 2:40857022-40857044 CCATGCTCATGGATGGAGCTGGG + Intergenic
933728719 2:85441035-85441057 GCAGAGACATGGATGGAGCTGGG + Intergenic
936531062 2:113277541-113277563 CCGCAGTGATGGATGGAGCCCGG - Intronic
936749761 2:115627823-115627845 GCAGAGACATGGATGGAGCCGGG - Intronic
940035616 2:149309687-149309709 CCATGGCCATGGTTAGAGCTTGG - Intergenic
940416000 2:153420851-153420873 CCATAGCCATTGCTGAGGCCTGG - Intergenic
944539621 2:200743212-200743234 CTATTGCCTTGGCTGGAGCCGGG - Intergenic
944660975 2:201921163-201921185 CCAGACCCCTGGAGGGAGCCTGG + Intergenic
945804774 2:214477268-214477290 CCCAAGCAATGGAAGGAGCCAGG + Intronic
946028080 2:216684259-216684281 TCACAGCAATGGATGGATCCAGG + Intronic
946432645 2:219633793-219633815 TCAGAGCCAGGGCTGGAGCCAGG + Intronic
946478386 2:220030761-220030783 CCATACCCATTGATGGAATCTGG + Intergenic
947152809 2:227131933-227131955 CCAGAGCCGTGGAGGGAGCCTGG + Intronic
947814139 2:233024554-233024576 CCCTAGCAATGGAAGGGGCCTGG + Intergenic
1170774104 20:19360066-19360088 CCATAGGCATGAATGGAAACTGG + Intronic
1174128430 20:48325604-48325626 CAATAGCAATGTCTGGAGCCAGG - Intergenic
1175377824 20:58541606-58541628 GCCTAGCCTTGGATGGAGGCCGG - Intergenic
1175500399 20:59446005-59446027 CCATAGCAAAGTCTGGAGCCTGG + Intergenic
1175864731 20:62169204-62169226 CCAAAGCCAAGTATGGAGCTGGG + Intronic
1178691221 21:34751841-34751863 CCACAGCTAGGGATGGAGCCAGG + Intergenic
1179556095 21:42177409-42177431 ACAGAGCCCTGGATGGAGCTGGG + Intergenic
1180040782 21:45278467-45278489 CCATAGCCGTCGGTGGATCCTGG - Intronic
1180253944 21:46609655-46609677 CCATAGACATGGATTGAGAGAGG - Intergenic
1182145648 22:27995225-27995247 TCTTAACCATGGATGGAGCTAGG + Intronic
1184772633 22:46606953-46606975 CCATAGCCATACAGGGGGCCAGG - Intronic
1185070552 22:48653504-48653526 CCACAGCCATGGGTCGGGCCGGG - Intronic
1185143048 22:49114054-49114076 GCATTTCCCTGGATGGAGCCTGG - Intergenic
950250431 3:11460870-11460892 CCATACACATGGATGGAATCAGG - Intronic
950477030 3:13221118-13221140 CCATAGCAAGGCCTGGAGCCAGG + Intergenic
950868287 3:16207182-16207204 CCATTGTCTTGGATAGAGCCAGG - Intronic
952611492 3:35215817-35215839 CCAGAGCCAAAGCTGGAGCCTGG + Intergenic
955009705 3:55002220-55002242 TCATAGCCATGGATGCAGGATGG - Intronic
959470864 3:106748207-106748229 CCCTAGGCTGGGATGGAGCCAGG + Intergenic
965206057 3:165720134-165720156 CCACAGCCTTGCATGGAGCAGGG - Intergenic
965460428 3:168955325-168955347 GCATGGCCATGGCTAGAGCCAGG + Intergenic
967993472 3:195149436-195149458 CTAGAGCCATGGCTGGAACCTGG + Intronic
968656935 4:1782770-1782792 CCACGGCCATGCAGGGAGCCCGG + Intergenic
968891206 4:3369428-3369450 CCAGAGCCATGGACCTAGCCTGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970063219 4:12060097-12060119 CTATTGTCATGTATGGAGCCAGG - Intergenic
971221919 4:24716760-24716782 ACATAGCCAGGAATGGAACCTGG + Intergenic
971221983 4:24716986-24717008 CCATGGCCATGGGTCCAGCCTGG + Intergenic
971316311 4:25571140-25571162 CTATAGCCTAGGATGGAACCTGG + Intergenic
972117685 4:35657710-35657732 GCAGGGACATGGATGGAGCCGGG - Intergenic
973866247 4:55116782-55116804 CTTCAGCAATGGATGGAGCCAGG - Intronic
974062017 4:57043861-57043883 CCATAGCCCTAGAGGAAGCCCGG - Intronic
974515150 4:62898246-62898268 CCACAGCCTTGCATGGAGCCAGG + Intergenic
979014653 4:115418497-115418519 CCTTATGCATGGAAGGAGCCTGG + Intergenic
981348426 4:143700672-143700694 CCATGGCCACGGATGGCTCCTGG + Exonic
983557634 4:169072581-169072603 CCTTAGCTATGGAGGGAGCTGGG - Intergenic
985725971 5:1515847-1515869 CCATAGCCAGGGACAGGGCCAGG - Intronic
986967243 5:13288711-13288733 GCAGAGGCATGGATGGAGCTGGG - Intergenic
997034624 5:130174862-130174884 CAGATGCCATGGATGGAGCCAGG - Intronic
998355909 5:141536410-141536432 CCATTGCCCAGAATGGAGCCTGG - Intronic
998649543 5:144102688-144102710 CCATAGCAGTGGCTGGAGCTAGG - Intergenic
999004663 5:147962474-147962496 CCCTAGCCCTGGATGGAGCTGGG + Intergenic
1001305283 5:170567907-170567929 CCTTTGCCAAGGATGTAGCCTGG - Intronic
1001590545 5:172861477-172861499 CCAGTGCCATCAATGGAGCCTGG + Intronic
1002351327 5:178585575-178585597 CCACAGCCCTGGATGGCGCTGGG + Intronic
1002351335 5:178585606-178585628 CCACAGCCCTGGATGGCGCTGGG + Intronic
1002351343 5:178585637-178585659 CCACAGCCCTGGATGGCGCTGGG + Intronic
1002351351 5:178585668-178585690 CCACAGCCCTGGATGGCGCTGGG + Intronic
1002571226 5:180140395-180140417 CCATTGCCTGGAATGGAGCCAGG - Intronic
1007262695 6:40575012-40575034 CCATTGCCATGGCTGGAGTCAGG - Intronic
1007738282 6:43995352-43995374 CCACAGCTATGGATGAAGCGGGG + Intergenic
1007755975 6:44099880-44099902 GCATAGTAATGGATGGAGCCAGG - Intergenic
1010174979 6:73017647-73017669 TTATAGCCCTGGAGGGAGCCAGG - Intronic
1019637294 7:2082768-2082790 CCATGACAATTGATGGAGCCCGG + Intronic
1019800892 7:3087631-3087653 CCATGGCCATGCCCGGAGCCAGG + Intergenic
1022873594 7:34504912-34504934 CCATAGACATGGAGGGAGACTGG - Intergenic
1028982270 7:96979984-96980006 AGATAGCCAGGGTTGGAGCCTGG - Intergenic
1029020159 7:97356914-97356936 CCCCAGCCCTGGATGGAGCAAGG - Intergenic
1031930813 7:127683987-127684009 CCAAAGCCATTAATGGGGCCAGG + Intronic
1032470472 7:132174862-132174884 CCAGTGACCTGGATGGAGCCGGG - Exonic
1034887651 7:154810325-154810347 CCATGGCCATGGATTTAGGCAGG + Intronic
1035392678 7:158515845-158515867 CCACAGCCATGGCTGTAGTCAGG + Intronic
1035856036 8:2977396-2977418 GCAGAGACATGGATGGAGCTTGG - Intronic
1035900033 8:3449410-3449432 CCTTAGGCATGGTGGGAGCCTGG - Intronic
1038459679 8:27705257-27705279 CCCCAGCCCTGGAGGGAGCCAGG - Intergenic
1039494724 8:37972362-37972384 CCATTGCCATGGTGGGGGCCTGG - Intergenic
1042782908 8:72511315-72511337 CCCTAGCCATGGGTAGATCCAGG + Intergenic
1043159685 8:76830076-76830098 CCATAGCAAGTGATGGAGCTGGG - Intronic
1051748973 9:20321961-20321983 CTATAGGCATGGGTGCAGCCAGG + Intergenic
1052249782 9:26384239-26384261 CCAAAGACAGGGAAGGAGCCTGG + Intergenic
1053372470 9:37574602-37574624 CCAGAGCCCTTGCTGGAGCCTGG - Intronic
1061798466 9:133101869-133101891 CCAAATCCATGCATGGGGCCAGG - Intronic
1062121311 9:134835469-134835491 CCACAGCCCTGGATGGGGCGAGG - Intronic
1062578140 9:137217989-137218011 CCAAAGCCATGGAGGGTGCCTGG + Intergenic
1195393735 X:104389167-104389189 CTATAGCCAAGAAAGGAGCCTGG - Intergenic