ID: 1096113398

View in Genome Browser
Species Human (GRCh38)
Location 12:49041556-49041578
Sequence TAGGGCAGTCAGGCTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 1, 2: 5, 3: 23, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096113393_1096113398 1 Left 1096113393 12:49041532-49041554 CCTGCTACAGGGGGAGACCAGGC 0: 1
1: 0
2: 1
3: 15
4: 255
Right 1096113398 12:49041556-49041578 TAGGGCAGTCAGGCTGCTGCAGG 0: 1
1: 1
2: 5
3: 23
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096113398 Original CRISPR TAGGGCAGTCAGGCTGCTGC AGG Intronic
900597055 1:3484960-3484982 GGGGGCAGTGAGGCTGATGCAGG + Intergenic
901105951 1:6756684-6756706 TATGACAGTGAGGCAGCTGCAGG + Intergenic
902975225 1:20083514-20083536 GAAGGCAATCAGGCAGCTGCCGG + Intronic
903128354 1:21262645-21262667 TAGCACAGCCAGGCTGCTCCTGG - Intronic
904537175 1:31207575-31207597 CAGGGGGGTCAGGCAGCTGCTGG - Intronic
904874695 1:33645025-33645047 TAGAGCACTTAGGCTGGTGCTGG + Intronic
905279350 1:36839022-36839044 TAGGGAGATCAGGCTGATGCTGG + Intronic
905986114 1:42284074-42284096 TAGGGTAGGCAGTCTGCGGCTGG - Intronic
906195860 1:43930488-43930510 CTGGGCAGCAAGGCTGCTGCCGG + Exonic
906477762 1:46181333-46181355 TATGGCAGCCTGGCTGCTGCTGG - Intronic
906801163 1:48738279-48738301 AAGATCAGTCAGACTGCTGCAGG + Intronic
907161691 1:52375503-52375525 CAGGGGAGTCAGGCTTCTGCTGG + Exonic
907265460 1:53257271-53257293 TAGGGTAGACGGGCTGATGCTGG + Exonic
909481508 1:76132321-76132343 GAGGGAAGGCAAGCTGCTGCTGG - Intronic
910825787 1:91405521-91405543 TAGGGCAGTCAGACAGCAGTAGG - Intergenic
911039673 1:93582024-93582046 GAGGGATGGCAGGCTGCTGCCGG - Intronic
912591377 1:110824375-110824397 CAGGGCAGTGGGGGTGCTGCAGG + Intergenic
913073986 1:115325645-115325667 AAGGGCACTCTGGCTGCTGTTGG + Intronic
915334074 1:155130391-155130413 GTGGGCAGTCAGGCTGGAGCCGG + Intronic
917928461 1:179807727-179807749 GAGGACAGACAGGCTCCTGCTGG - Intronic
918388714 1:184036900-184036922 TCGGGCGGTCAGGCTGCGGAGGG - Intronic
919892146 1:201983135-201983157 AAGGGCAGGCAGGCAGCGGCGGG - Intronic
920183183 1:204145129-204145151 TTGGGCAGTCAGGCAGCTTAGGG + Intronic
920313409 1:205061528-205061550 TAGGGCAAGCAGGCTCATGCAGG - Intronic
920764771 1:208821667-208821689 AAGGGAAGGCAGGCTGCTGCTGG + Intergenic
922240285 1:223751157-223751179 GAAGGCACTCAGGCTGCTGGAGG - Intronic
923526720 1:234778562-234778584 TGGGGCTGGCGGGCTGCTGCTGG + Intergenic
923630306 1:235645255-235645277 CAGGGCAGGGAGGCTGCTGAGGG - Intronic
923778605 1:237001623-237001645 CATGGCATGCAGGCTGCTGCTGG - Intergenic
1063588310 10:7372880-7372902 TAGGGCAGGCAGGGGGCTGCAGG - Intronic
1064231926 10:13536721-13536743 AAGAGCACACAGGCTGCTGCAGG + Intergenic
1064516027 10:16149365-16149387 TAGGACAGTGAGGCTGCGGAAGG - Intergenic
1065025428 10:21535221-21535243 TGCGGCAGACAGGCGGCTGCAGG - Intronic
1066300898 10:34094588-34094610 TTGGTCAGTAAGGCTGGTGCTGG - Intergenic
1066975989 10:42368027-42368049 CCGGGCAATCAGGCTGCAGCTGG - Intergenic
1068798087 10:61106498-61106520 TAAGGCACTCAGGCTTTTGCTGG + Intergenic
1068935871 10:62635252-62635274 TAGGTCATTCTGGCTTCTGCTGG + Intronic
1069683321 10:70300478-70300500 CAAGGCAGCCAGGCTGCTGCTGG + Exonic
1070087627 10:73252344-73252366 TAAGGCAGTGTGGCTGCTTCAGG + Intronic
1070103879 10:73414018-73414040 TTGGGCTGTGACGCTGCTGCTGG - Exonic
1070729913 10:78819549-78819571 TAGGGCTGTCAGGATGCTGTAGG + Intergenic
1075617969 10:123905281-123905303 CAGGGCAGTCAAGCTGCTCGCGG - Intronic
1075681920 10:124339406-124339428 CAAGCCAGGCAGGCTGCTGCAGG + Intergenic
1076688580 10:132209245-132209267 CCGGGCAGTCTGGCTGCTGGAGG - Intronic
1077192678 11:1261976-1261998 TGGGGCAGACAGGCTGGTCCAGG + Exonic
1077383198 11:2257067-2257089 GAGGGCAGTGAGGCTGAGGCTGG + Intergenic
1078097926 11:8311819-8311841 TAGGGGACTGAGGCTGCGGCAGG - Intergenic
1081568429 11:44275066-44275088 AGGGGCAGGAAGGCTGCTGCTGG - Intronic
1081814579 11:45931332-45931354 CAGGGCAGACAGCCTGCTGCTGG + Intronic
1081935343 11:46899986-46900008 CAGAGCAGTCAGGCTGCTGCAGG + Intronic
1083343082 11:61971495-61971517 GAGGGAAGTCGGTCTGCTGCAGG + Intergenic
1083378433 11:62244620-62244642 GGGGTCAGTCATGCTGCTGCTGG - Intronic
1083384311 11:62296455-62296477 GAGGTCAGTCATGCTGCTGCTGG + Intronic
1084702440 11:70796187-70796209 TAGGGCACACAGGGTGATGCTGG + Intronic
1087534298 11:99424517-99424539 TAAGGCAGGCAGGCAGCTCCTGG + Intronic
1088921265 11:114261167-114261189 TGGAGTAGTGAGGCTGCTGCCGG + Intronic
1090269050 11:125373059-125373081 TAGGGCTGTCAGGATCATGCCGG - Intronic
1090636228 11:128692229-128692251 GAGGGCAGGCAGCCTGCCGCGGG + Intronic
1091220661 11:133928277-133928299 TAGGGCCCCCACGCTGCTGCGGG + Intronic
1091665332 12:2414817-2414839 GAGGGCAGTCAGGTGTCTGCCGG + Intronic
1092255753 12:6926097-6926119 TCTGGCAGTCAGTCTGCTCCCGG - Intronic
1096113398 12:49041556-49041578 TAGGGCAGTCAGGCTGCTGCAGG + Intronic
1098071449 12:66679964-66679986 TATGGCGAGCAGGCTGCTGCTGG - Intronic
1101036927 12:100716165-100716187 GAGGGCAGCCAGGCGGCGGCGGG - Intergenic
1101978579 12:109384839-109384861 TACTGCAGTCAGGTTGCTGCAGG - Intronic
1103049093 12:117763756-117763778 AAGATCACTCAGGCTGCTGCGGG + Intronic
1103573039 12:121857509-121857531 TAGGGCAGGCAGGCTGAGGGGGG - Intronic
1103706792 12:122879280-122879302 TAGGTCAGCCAGGTGGCTGCTGG - Intronic
1106227905 13:27798835-27798857 TAGGGCAGTCAGAGGCCTGCTGG + Intergenic
1106456168 13:29929243-29929265 TAGGGAAGTCAGGCTAAGGCAGG - Intergenic
1108418882 13:50228617-50228639 TAGGGCAGTAGGGCTGCTGCAGG - Intronic
1109013937 13:56983780-56983802 CAGGGCAATCAGGCAGCAGCAGG + Intergenic
1109400162 13:61816881-61816903 CAGGTCAGGCAGGCTGCTGTTGG - Intergenic
1111742350 13:92219616-92219638 TCAGTCAGTCAGGCTGCTCCTGG + Intronic
1118085667 14:62413378-62413400 TGGGGAAGTCTGGCTTCTGCTGG + Intergenic
1119397521 14:74338305-74338327 GAGGGCTGTCAGGCTGATGCTGG - Intronic
1119472975 14:74910779-74910801 GAGGCCAGTCAGGCTGTTGTGGG - Intronic
1120499191 14:85273194-85273216 TAGGTCATTCACGCTGCTGCTGG - Intergenic
1121660607 14:95632509-95632531 CAGGGCAGAGAGGCAGCTGCTGG - Intergenic
1122251674 14:100444364-100444386 TGGGTCAGGGAGGCTGCTGCAGG + Intronic
1122470251 14:101961477-101961499 TGGGGCTGTCAGGGTGCTGCTGG - Intergenic
1122717491 14:103704264-103704286 AAGGGGAGGCAGGCTGCTGGGGG + Intronic
1123001830 14:105300023-105300045 AGGGCCACTCAGGCTGCTGCAGG - Intronic
1123041949 14:105493936-105493958 GAGGGCGGGCAAGCTGCTGCGGG + Intronic
1123114331 14:105887096-105887118 CAGGGCAGGCAGGCACCTGCTGG - Intergenic
1124416211 15:29475006-29475028 TAGGGCACACAGGTTTCTGCAGG - Intronic
1125325260 15:38530151-38530173 TAGTGCAGGCTGGGTGCTGCTGG + Intronic
1126892805 15:53224069-53224091 GGAGGCAATCAGGCTGCTGCTGG + Intergenic
1127810190 15:62559145-62559167 GAGGGAAGTCAGGCTGCTGGAGG - Intronic
1127996913 15:64158515-64158537 TAGGGCAGGCAGGCTGCTGGGGG - Intronic
1130347659 15:83063704-83063726 TAGGCCAGACAGGATGGTGCAGG - Intronic
1131220947 15:90583623-90583645 TAGTGCTGGCAGGCTGCTGGGGG + Intronic
1131713968 15:95088266-95088288 TCTGGCAGTCAGGCTGCACCTGG + Intergenic
1131876486 15:96812174-96812196 TAAGCCAGTCAGGCTTCTGTGGG + Intergenic
1132513038 16:353368-353390 GAGGGCAGTCAGGGGGCTGCAGG + Intergenic
1136246723 16:28980470-28980492 GAGGGCAGCCAGTCTCCTGCAGG - Intronic
1138104052 16:54277569-54277591 TGGGCCAGCCAGGCTCCTGCGGG + Intergenic
1139594863 16:67951604-67951626 TGGGGAAGACAGGCTGCTGCAGG + Intronic
1141828395 16:86496464-86496486 CAGGGCAGCCAGGCTGATGCGGG - Intergenic
1142594496 17:1022942-1022964 TGGGGAAGGCAGGTTGCTGCGGG - Intronic
1143497214 17:7319079-7319101 ACGGGCAGCCTGGCTGCTGCGGG - Exonic
1143729751 17:8874386-8874408 TTGGGCAGACAGGGGGCTGCGGG + Intergenic
1146626853 17:34441588-34441610 TAGGGCTCAAAGGCTGCTGCAGG - Intergenic
1147168311 17:38604830-38604852 TAGGGAAGGCAGGCGGCTGAGGG - Intronic
1147359396 17:39921665-39921687 TAGGGGAGGGAGGCTGCTGTGGG - Intronic
1147817002 17:43217498-43217520 TAGGGCTGTCTGGAAGCTGCTGG + Intronic
1148485355 17:47987404-47987426 GAGGGCATCAAGGCTGCTGCAGG + Intergenic
1148965863 17:51435541-51435563 TTGGGCAGTTACGCAGCTGCTGG + Intergenic
1151126118 17:71846529-71846551 TATGGCACCCAGGCTGCTTCTGG - Intergenic
1152034780 17:77865445-77865467 TGGGGCAGGCAGCCGGCTGCAGG + Intergenic
1152661078 17:81542419-81542441 CTGGGCAGTGAGGCTCCTGCAGG + Intronic
1156368075 18:36447914-36447936 GAGGGCAGTCAGGCAGCTGGAGG + Intronic
1157931025 18:51823670-51823692 TAGGGCATCCAAGCTGCTGGTGG - Intergenic
1161206574 19:3044365-3044387 TAGGGCAGGCAGGATTCTACAGG + Intronic
1161328573 19:3675415-3675437 AAGGGCAGCCAGTCTGCTGCAGG + Intronic
1162087060 19:8255377-8255399 TAGGGCAGGCAGGTCGCTGACGG - Intronic
1162152785 19:8657431-8657453 TTGGGGACTCTGGCTGCTGCAGG + Intergenic
1162263807 19:9553446-9553468 GAGTGCAGTCATGCTGCTGTAGG - Intergenic
1164297930 19:23931807-23931829 TACTGCAGTCTGGCGGCTGCTGG + Intronic
1165821008 19:38676049-38676071 CAGGGCTGTCAGGATGCAGCGGG + Intronic
1165901843 19:39172950-39172972 TGGGGCCCTCACGCTGCTGCTGG + Exonic
1166819888 19:45571560-45571582 TATGGCAGCCAGGCTGCTGCTGG - Intronic
1168407550 19:56118843-56118865 CAGGGCAGCCAGGCAGTTGCTGG + Intronic
1168638383 19:58013693-58013715 GAGGGAACTCAGACTGCTGCTGG - Intergenic
928103390 2:28452445-28452467 CAGGCCGGTCAGGCTCCTGCTGG + Intergenic
928437837 2:31267183-31267205 GAGGGCAGGCGGGCAGCTGCAGG + Exonic
929811369 2:45191718-45191740 AAGGGTAGGGAGGCTGCTGCAGG + Intergenic
930014199 2:46959307-46959329 TGGGTCAGTCAGGCTCCTGCAGG - Intronic
930410068 2:51014135-51014157 AAGTGCAGTGATGCTGCTGCTGG + Intronic
930771513 2:55134724-55134746 TTGGGCACTCAGGGGGCTGCAGG - Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
933202806 2:79470027-79470049 TAGGGCAGTCAGGCAGGAGAAGG + Intronic
935121728 2:100188910-100188932 ATGGGCACTCAGGCTGCTTCTGG + Intergenic
935146019 2:100396049-100396071 TGGGGCTGTGAAGCTGCTGCGGG - Intronic
935232763 2:101113554-101113576 CAGGGCTGTCAGGCTGCAGGCGG - Intronic
935314011 2:101813382-101813404 AAGGGCACTCACACTGCTGCAGG - Intronic
936944131 2:117915279-117915301 TGGGACAGACGGGCTGCTGCAGG - Intergenic
943367786 2:186982060-186982082 TAGGGCACTGTGGCTGCAGCTGG - Intergenic
946461146 2:219869997-219870019 CAGGGATGTCAGGCTTCTGCTGG + Intergenic
1169135486 20:3194725-3194747 CAGGGCATTCAGGCTCATGCAGG - Intronic
1170130290 20:13011619-13011641 TGGGGCAGCAAGCCTGCTGCAGG - Intronic
1170440601 20:16375394-16375416 TAGAGCAGTCAAATTGCTGCTGG - Intronic
1170603463 20:17859220-17859242 TAGGGCAGTCGGGTTGCAGCTGG + Intergenic
1171395846 20:24832639-24832661 GAGAGCAGACAGGCTGCTGTGGG + Intergenic
1172125684 20:32623939-32623961 TAGGGCAGTCTGACCCCTGCTGG + Intergenic
1172493449 20:35360273-35360295 TAGGGCATTCAGGCTTCTGCTGG - Intronic
1173867588 20:46322488-46322510 AAGGGCAGTCTGGCTGGTGATGG - Intergenic
1174338709 20:49882910-49882932 TAGGGCAGCCAGGCTGCTGCAGG - Intronic
1179883124 21:44301672-44301694 GAGGGCAGACAGGTTGCTGTGGG + Intronic
1180119453 21:45737081-45737103 TGGGGCAGTGAGGAGGCTGCGGG + Intronic
1180959500 22:19756218-19756240 TAGCGCAGGTAGGCTGCCGCTGG - Intergenic
1181968605 22:26673386-26673408 TGGGGCAGTCAGGGTGAGGCAGG - Intergenic
1182025033 22:27111281-27111303 TAGGGCTCCCAGTCTGCTGCTGG + Intergenic
1184517470 22:44971548-44971570 TGGGGAATTCAGGCTTCTGCAGG - Intronic
1185131956 22:49044332-49044354 AGGGGCAGCAAGGCTGCTGCTGG + Intergenic
1185190022 22:49429406-49429428 TCGGGGATTCAGGCTGCTCCTGG - Intronic
1185337043 22:50275348-50275370 TAGGGCATGGAGGCGGCTGCTGG + Exonic
950107344 3:10396671-10396693 TGGGGGAGGCAGGCTGCTGCAGG + Intronic
950677051 3:14560615-14560637 TGTGTCAGTCAGGCTGCTGGCGG + Intergenic
953342782 3:42149680-42149702 TAGGGGAGACAGGCGGCTGGCGG + Intronic
954297369 3:49681744-49681766 GAGGGCTGCCAGGCTGCAGCAGG - Exonic
954802415 3:53194805-53194827 GAGGGCAGTCTGCCTGCTTCAGG - Intergenic
961782604 3:129329575-129329597 AAGGGCAGCCAGGTTTCTGCTGG - Intergenic
963808629 3:149752435-149752457 TAGGACAGTGAAGATGCTGCTGG - Exonic
964415380 3:156442741-156442763 TAGGGCAGGCTGTCTGCAGCTGG - Intronic
967117607 3:186355714-186355736 TAGGACAGTGATGCTGGTGCTGG - Intronic
967923392 3:194629290-194629312 TGGGGCAGCCTGGCTTCTGCTGG + Intronic
968669850 4:1843401-1843423 GAGGGCAGTGCGGCTGGTGCAGG + Intronic
968704622 4:2072174-2072196 AGGGGCAGCCAGGCTGTTGCTGG + Exonic
969262155 4:6040875-6040897 CAGGTCAGTGAGGCTCCTGCTGG - Intronic
969499126 4:7542494-7542516 GAGGGGAGTGAGGCAGCTGCAGG + Intronic
975041709 4:69752724-69752746 TAGTTCAGTCAGCCTGCTGAGGG + Intronic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
980730841 4:136823211-136823233 TAAGGCAGGCTGGCTGCGGCAGG + Intergenic
984629764 4:182049053-182049075 TGGGGGAGTCAGGCAGCAGCTGG + Intergenic
984671307 4:182491065-182491087 TGAGGCAGTCAGCCTGCTCCTGG + Intronic
985577600 5:680889-680911 GAAGTCAGCCAGGCTGCTGCTGG + Intronic
985592530 5:772987-773009 GAAGACAGCCAGGCTGCTGCTGG + Intergenic
985643994 5:1076561-1076583 GTGGGCAGTCAGGATCCTGCCGG - Intronic
993351508 5:86855731-86855753 CAGGGCAGGCAGGCTGCAGATGG - Intergenic
1001245095 5:170100299-170100321 CAGGTCAGTCTGCCTGCTGCTGG + Intergenic
1001852287 5:174980066-174980088 TAGGGCAGTCATGTTGGTGAGGG + Intergenic
1001886228 5:175293139-175293161 GAGGACAGTAAGGCAGCTGCAGG - Intergenic
1002206779 5:177568476-177568498 GGGTGCAGTCAGGCTGCTGGTGG + Intergenic
1002837186 6:874828-874850 AAGGGAAAACAGGCTGCTGCTGG - Intergenic
1003373494 6:5551672-5551694 TAGGCCAATCAGGCTGATTCTGG - Intronic
1003916590 6:10792356-10792378 CAGAGGAGGCAGGCTGCTGCTGG - Intronic
1004562380 6:16762026-16762048 AAGGGCTGTCAGGCTTCAGCTGG + Intergenic
1006518622 6:34558625-34558647 TAAGGCAGGCAGTCTGCAGCTGG - Intergenic
1007394026 6:41567063-41567085 CAGGGGAGTCAGGCTTCTGATGG - Intronic
1007551385 6:42732619-42732641 AAGGGGAGGCAGGCTGCTTCAGG + Intergenic
1016948037 6:149552061-149552083 TAGCGCAGGCAGGCAGCTGTAGG + Intergenic
1017653931 6:156608822-156608844 TAGGGCAGTCAGGCAGGAGAAGG + Intergenic
1018804595 6:167248964-167248986 CAGGGCAGGCAGGGTGGTGCAGG + Intergenic
1020155902 7:5724232-5724254 AAGGGCAGTCAGGCTGATGAAGG + Intronic
1022012865 7:26324103-26324125 TTGAGCATTCAGGCTGCTTCAGG - Intronic
1022265209 7:28746908-28746930 TAGGGCAGGAAGGCTGATGAAGG + Intronic
1023311621 7:38893174-38893196 TGGGGCAGTGAGGCTGGTGAAGG - Intronic
1023616395 7:42024601-42024623 TAGGGCTCTCAGCCTGATGCAGG - Intronic
1024008376 7:45244217-45244239 TAGGGCAGTCAGGAACCTCCAGG - Intergenic
1024342524 7:48281953-48281975 TAGGGAATTCAGGTTACTGCAGG - Intronic
1024980398 7:55153262-55153284 TGGGGCAGCAAGGCTTCTGCTGG - Intronic
1028211663 7:88081488-88081510 TAGGGCAGTCAGGCAGGAGAAGG + Intronic
1033216261 7:139495732-139495754 CAGGGAAGTCAGGCCACTGCAGG + Intergenic
1033300058 7:140177225-140177247 AAGGGCACGCAGGCGGCTGCGGG + Intergenic
1033805099 7:144944749-144944771 TTTGGCAGTTAGGCTGCTGAGGG - Intergenic
1035885563 8:3287796-3287818 CAGGGCAATCAGGCAGCTGGAGG - Intronic
1035927644 8:3745668-3745690 CGGGGAAGTCAGGCAGCTGCTGG + Intronic
1036731127 8:11265840-11265862 GAGGTCAGACAGGCAGCTGCTGG - Intergenic
1036939691 8:13039606-13039628 TAGGTCAGTAAGGCTGCATCAGG + Intergenic
1037835040 8:22210709-22210731 CAGGGCAGCCAAGCTGCTTCAGG - Intronic
1039006967 8:33050370-33050392 GAGGGCAATCAGGAAGCTGCAGG - Intergenic
1040935991 8:52782706-52782728 TAAGGAAGCCAGGCTGCTGCTGG - Intergenic
1041732386 8:61075721-61075743 ATGGGCAATCAGGGTGCTGCTGG - Intronic
1044849825 8:96417552-96417574 GAGGGAAGTCAGGCTGCAGAAGG - Intergenic
1049835556 8:144733465-144733487 TTGGGAACTCAGGCCGCTGCCGG - Intronic
1050364905 9:4864885-4864907 TAGAGCACTTGGGCTGCTGCCGG + Intronic
1050381552 9:5035878-5035900 CAGGGCAGTCAGGCTGGAGAAGG + Intronic
1053063038 9:35046077-35046099 TAGAGCACTCAGGATTCTGCAGG + Intergenic
1053282735 9:36831631-36831653 TGGGGGAGTGAGACTGCTGCAGG - Intergenic
1055788668 9:79898421-79898443 TAGGTCAGCCAGGTTGCTGTAGG - Intergenic
1057211455 9:93203080-93203102 TGGGGCAGTGATGCTTCTGCTGG + Intronic
1058754904 9:108075224-108075246 TGGGCCACTCTGGCTGCTGCCGG - Intergenic
1059310989 9:113389091-113389113 GAGGGAGGTCAGGGTGCTGCAGG + Exonic
1061392416 9:130324982-130325004 TAGGGCAGTGAAGCTACTCCAGG - Intronic
1061627277 9:131848494-131848516 GAGGGAAGGCAGGCTGCCGCTGG + Intergenic
1062402986 9:136380557-136380579 TGGGGAAGTCAGGCAGGTGCAGG - Intronic
1190283337 X:48945956-48945978 TAGGTCAGGCTGGCTGCTTCTGG - Intronic
1193755972 X:85408903-85408925 TGGGGCAGACAAGGTGCTGCTGG - Intergenic
1195527530 X:105909096-105909118 TAGGGCACCTAGGCTTCTGCAGG + Exonic
1198059343 X:133028982-133029004 TAGGCTAGTGAGGCTCCTGCAGG + Intronic