ID: 1096116371

View in Genome Browser
Species Human (GRCh38)
Location 12:49057893-49057915
Sequence TCTTAGGTATAGGACTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096116371_1096116381 6 Left 1096116371 12:49057893-49057915 CCCCCTCAGTCCTATACCTAAGA 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1096116381 12:49057922-49057944 AAACAGCAAAGAAAAGGACAGGG 0: 1
1: 0
2: 9
3: 139
4: 1630
1096116371_1096116378 0 Left 1096116371 12:49057893-49057915 CCCCCTCAGTCCTATACCTAAGA 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1096116378 12:49057916-49057938 GGTCCAAAACAGCAAAGAAAAGG 0: 1
1: 0
2: 2
3: 21
4: 448
1096116371_1096116380 5 Left 1096116371 12:49057893-49057915 CCCCCTCAGTCCTATACCTAAGA 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1096116380 12:49057921-49057943 AAAACAGCAAAGAAAAGGACAGG 0: 1
1: 2
2: 9
3: 186
4: 2271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096116371 Original CRISPR TCTTAGGTATAGGACTGAGG GGG (reversed) Intronic
900458928 1:2790887-2790909 TCTCAGGTCTAGGACTGGAGGGG + Intronic
901508106 1:9699424-9699446 TTTTAAGCAGAGGACTGAGGCGG - Intronic
904247557 1:29198511-29198533 TGTCAGGTATAGGGCTGAAGCGG + Intronic
904334909 1:29790550-29790572 TCTTAGGTCTAGGACTGCAATGG + Intergenic
907598721 1:55745509-55745531 ACTTAGGTTTAGGACTGATTTGG - Intergenic
910884373 1:91949894-91949916 TCTTAGGTCTTGGACTGGTGTGG + Exonic
911911636 1:103644825-103644847 TCTTAGGTGTCTGACAGAGGGGG - Intergenic
911916818 1:103707125-103707147 TCTTAGGTGTCTGACAGAGGGGG + Intronic
911919051 1:103738963-103738985 TCTTAGGTGTCTGACAGAGGGGG - Intronic
915669922 1:157479461-157479483 TCTGATGTTTAGGACTGTGGGGG + Intergenic
916386087 1:164272232-164272254 TTATAGGTATAGGACTAAAGTGG + Intergenic
1063405198 10:5787649-5787671 TCTTAAGTATAGTGCTGATGTGG - Intronic
1068486246 10:57662666-57662688 TCTTAGGTATAGGCCGGGCGCGG - Intergenic
1069538869 10:69278109-69278131 TGGTAGGGTTAGGACTGAGGGGG + Intronic
1070627666 10:78062785-78062807 ACTTAGGGATAGGAGTGAAGGGG - Intergenic
1072608994 10:97004332-97004354 TCTAAGGAAAAGGACTGTGGGGG + Intronic
1072752795 10:97995324-97995346 TCTTGGGTATAAGACAGATGAGG - Intronic
1074746919 10:116543555-116543577 TTTTAGGAACAGGACTGACGGGG + Intergenic
1078717720 11:13855696-13855718 TCGTTTGTACAGGACTGAGGTGG - Intergenic
1087137276 11:94733600-94733622 TCTAAGGCAGAGGCCTGAGGGGG - Intronic
1090921980 11:131214870-131214892 CCTGAGCTATAGGACTGACGGGG + Intergenic
1092999616 12:13982054-13982076 TCTTAGCAAGAGGAGTGAGGGGG - Intergenic
1096116371 12:49057893-49057915 TCTTAGGTATAGGACTGAGGGGG - Intronic
1096333115 12:50732078-50732100 TCTAAGGTACAGAAATGAGGAGG + Intronic
1096467852 12:51857388-51857410 GCATAGGAATAGGGCTGAGGAGG - Intergenic
1099012636 12:77309948-77309970 TCTGAGGTATTGGTTTGAGGAGG + Intergenic
1113406165 13:110042640-110042662 TCTTAAGTAAAGGACTCACGAGG - Intergenic
1114239219 14:20850668-20850690 CCTTAGGAAAATGACTGAGGTGG + Intergenic
1116120359 14:40715656-40715678 TCTTAGATATAATACTGAGTGGG - Intergenic
1127019964 15:54735722-54735744 ACTTAGGTTAAGGACTGAGTGGG - Intergenic
1129274386 15:74435414-74435436 GCTTAGGTGCAGGCCTGAGGAGG - Intergenic
1129543297 15:76369412-76369434 TCTTAAGTATAGAAGTGAGGTGG + Intronic
1131053972 15:89364885-89364907 GCCTGGGTTTAGGACTGAGGGGG + Intergenic
1131567910 15:93503539-93503561 TCTTGGAAAAAGGACTGAGGTGG + Intergenic
1132351259 15:101141073-101141095 TCTCAGGTTTAGGAGTCAGGGGG + Intergenic
1136984812 16:35090924-35090946 TCTGAGGTATAGAACCAAGGAGG - Intergenic
1137243606 16:46683171-46683193 TCTGAGGTATAGAACCAAGGAGG + Intronic
1141198653 16:81880687-81880709 TCTTGGGAATACGACTGTGGAGG + Intronic
1142654422 17:1381798-1381820 TCCCAGGCATAGGACTGAGGTGG + Intronic
1152317644 17:79590164-79590186 TCCTGGGTATAGGACGGATGGGG - Intergenic
1155062139 18:22238123-22238145 TTTTAGGTTTAGGTCTGGGGAGG - Intergenic
1155782657 18:29857471-29857493 TCTTAGCAATAGGATTGAGGGGG + Intergenic
1159036629 18:63284448-63284470 TCTTAGGAATAGGACTTCTGGGG - Intronic
925313459 2:2904580-2904602 TCTTATGGGTAGGAGTGAGGAGG + Intergenic
926254929 2:11185038-11185060 TCTGGGGTATGGGAGTGAGGAGG - Intronic
927645592 2:24875012-24875034 TCTTAGGTAGACAACCGAGGGGG + Intronic
930531505 2:52594447-52594469 TCTTAGGAATAGGAGTAGGGAGG + Intergenic
940235688 2:151508602-151508624 TCCCAGCTATAGGACTGAGCCGG + Intronic
942380079 2:175381649-175381671 TCTTTGGGAGATGACTGAGGAGG + Intergenic
946115239 2:217455570-217455592 TCTTAGGTATAGAAAGGAGGAGG + Intronic
1169555403 20:6744107-6744129 CATTAGGTACAGGACTGTGGTGG + Intergenic
1170854088 20:20033492-20033514 TCTCAGGCACAGAACTGAGGAGG - Exonic
1177665179 21:24147376-24147398 TCTAAGGTCTAGGAATGAGGAGG + Intergenic
1178133266 21:29597438-29597460 TCTTATGTATAGCACTGAAGGGG - Intronic
951164165 3:19464826-19464848 ACTTAGATAAAAGACTGAGGAGG - Intronic
953308661 3:41854841-41854863 TCTTGAGTATTGGACTGTGGTGG - Intronic
959515544 3:107262720-107262742 TCTTAGGTAAATGAGGGAGGTGG - Intergenic
962019564 3:131484173-131484195 TGCTAGGTAGAGGAGTGAGGAGG + Intronic
962586362 3:136846237-136846259 TCTCAGCCATAGGAATGAGGTGG + Intronic
965834670 3:172838234-172838256 TCTCAGGTATCTGACTCAGGTGG - Intergenic
966649111 3:182279383-182279405 TCTTGTGTATAGGTCTGTGGTGG + Intergenic
974601483 4:64087851-64087873 TCTTGGGTATATGCCTGGGGTGG + Intergenic
974714450 4:65649266-65649288 TCTTAAGTAGAGGACTGACTTGG - Intronic
977858135 4:101920907-101920929 TGTTAGGTATATGAAGGAGGAGG + Intronic
980297890 4:130945828-130945850 TCTCAGGTAAAAGACTGAGGAGG + Intergenic
981738400 4:147977008-147977030 TGTTAGGGATGGGATTGAGGTGG + Intronic
986899697 5:12416293-12416315 TTTTAGGAATAGGAAGGAGGAGG + Intergenic
991475601 5:67015589-67015611 TCTTAGGGATTGGACTGGGAGGG + Intronic
995626879 5:114089335-114089357 TCTTAGGAATAGGACTAAGCCGG - Intergenic
997575639 5:134974845-134974867 TGTTAGGTATAGGACTTGGCAGG + Intronic
997788838 5:136738464-136738486 GCTTAGGGTTGGGACTGAGGAGG - Intergenic
1002850893 6:995540-995562 TTTCAGGTATAGGACTGGTGAGG + Intergenic
1004085165 6:12440502-12440524 TTTTAGGCATAGGAGTGATGTGG - Intergenic
1012715191 6:102660323-102660345 TGCTGGGTATAGGAGTGAGGTGG - Intergenic
1021605303 7:22403834-22403856 ACAGAGGTATAGGACAGAGGTGG + Intergenic
1022810669 7:33864745-33864767 TCTTATTCATAGGTCTGAGGTGG + Intergenic
1026399177 7:69991926-69991948 TCAAAGGTATAGTACAGAGGAGG - Intronic
1027656624 7:80938374-80938396 TCTAAGGTATAGAAGTGTGGTGG - Intergenic
1027684814 7:81267029-81267051 TCCTCGGTATCGGACTGAGTGGG + Intergenic
1033480353 7:141734257-141734279 TTTTAGGTAGAGGCCTGAGGAGG + Intergenic
1034217007 7:149415497-149415519 TCTTGGGAAGAGGACAGAGGTGG - Intergenic
1038209565 8:25503465-25503487 GCTCGGGAATAGGACTGAGGAGG - Exonic
1044208088 8:89515844-89515866 ATTTGGGTATAGGACTGAGAGGG - Intergenic
1048533221 8:135269624-135269646 TCTCAGGTATAGGACTGCTAAGG + Intergenic
1051336424 9:16070318-16070340 TCAGAGGTAAAGGACAGAGGAGG + Intergenic
1052213906 9:25941278-25941300 TGTTGGGTATAGGTGTGAGGTGG - Intergenic
1056506979 9:87266802-87266824 TCTTTACTCTAGGACTGAGGTGG - Intergenic
1057089494 9:92244311-92244333 GCCTGGGTAAAGGACTGAGGAGG + Intronic
1190055419 X:47178657-47178679 TCTTAGCTCTAGGACTGGGTTGG - Intronic
1190334236 X:49252839-49252861 GGTTAGGTATGGGGCTGAGGTGG + Intronic
1194011307 X:88566048-88566070 TGTTAGGTCAAGGACTGAGTAGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic