ID: 1096116811

View in Genome Browser
Species Human (GRCh38)
Location 12:49059961-49059983
Sequence AGCGCCCCGGCCGCCCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 268}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096116806_1096116811 -9 Left 1096116806 12:49059947-49059969 CCTAGGGCCCGGCCAGCGCCCCG 0: 1
1: 0
2: 2
3: 36
4: 355
Right 1096116811 12:49059961-49059983 AGCGCCCCGGCCGCCCGCGCCGG 0: 1
1: 1
2: 2
3: 23
4: 268
1096116800_1096116811 16 Left 1096116800 12:49059922-49059944 CCGCGTCGCCGGGCGGCCTCTCA 0: 1
1: 0
2: 1
3: 12
4: 90
Right 1096116811 12:49059961-49059983 AGCGCCCCGGCCGCCCGCGCCGG 0: 1
1: 1
2: 2
3: 23
4: 268
1096116805_1096116811 0 Left 1096116805 12:49059938-49059960 CCTCTCAGTCCTAGGGCCCGGCC 0: 1
1: 0
2: 0
3: 17
4: 144
Right 1096116811 12:49059961-49059983 AGCGCCCCGGCCGCCCGCGCCGG 0: 1
1: 1
2: 2
3: 23
4: 268
1096116799_1096116811 22 Left 1096116799 12:49059916-49059938 CCGCATCCGCGTCGCCGGGCGGC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1096116811 12:49059961-49059983 AGCGCCCCGGCCGCCCGCGCCGG 0: 1
1: 1
2: 2
3: 23
4: 268
1096116801_1096116811 8 Left 1096116801 12:49059930-49059952 CCGGGCGGCCTCTCAGTCCTAGG 0: 1
1: 0
2: 0
3: 20
4: 145
Right 1096116811 12:49059961-49059983 AGCGCCCCGGCCGCCCGCGCCGG 0: 1
1: 1
2: 2
3: 23
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096116811 Original CRISPR AGCGCCCCGGCCGCCCGCGC CGG Intergenic