ID: 1096118960

View in Genome Browser
Species Human (GRCh38)
Location 12:49074202-49074224
Sequence TCATCCTAATGTTAGATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096118960 Original CRISPR TCATCCTAATGTTAGATAAA TGG Intergenic
902803868 1:18848843-18848865 TCACCCTAATGTAATATTAATGG - Intronic
904092157 1:27952840-27952862 TCATCTTACTGTTAGGGAAAGGG - Intronic
906521679 1:46470390-46470412 TCATCCCAAAGGTGGATAAAGGG + Intergenic
908409026 1:63844105-63844127 TCATCCTAATGTTAGCAATGAGG - Intronic
910123154 1:83812565-83812587 GCATCATAATGTTCAATAAATGG + Intergenic
912087887 1:106033066-106033088 GATTCCTAATGTTAGATATAGGG + Intergenic
913612437 1:120521440-120521462 TCATCCTTATTTTATATAAAAGG - Intergenic
914371108 1:147025135-147025157 TCATCCTTATTTTATATAAAAGG - Intergenic
914578753 1:149000798-149000820 TCATCCTTATTTTATATAAAAGG + Intronic
916299594 1:163259040-163259062 TCATCGTCATGTTATATACATGG - Intronic
917030718 1:170687563-170687585 TAATCCTCATTTTAGAGAAAAGG - Intronic
918673391 1:187249926-187249948 TTATTCTAAGGTTAGATCAAAGG - Intergenic
918674999 1:187272986-187273008 TCATTCTAATGTGAGAAATAAGG - Intergenic
918875305 1:190033639-190033661 TCATCCTAATGTATGGTAATTGG - Intergenic
919644346 1:200079050-200079072 TAATCCTCATGTTACAGAAATGG + Intronic
919874099 1:201848911-201848933 TCATCTTAATTTTATATAAAAGG - Intronic
921248418 1:213272246-213272268 TCATCCTCATGTAATATAATAGG - Intronic
923056936 1:230433755-230433777 TCTTCCTATTCTTAGATAATGGG + Intergenic
923917400 1:238524528-238524550 TCATCTAAATATTAGATTAATGG - Intergenic
924721031 1:246623374-246623396 TAATCCTAATGTAACAAAAACGG + Intronic
1065338692 10:24681992-24682014 TCATCCTCATGTTAAAGACAAGG - Intronic
1066406007 10:35119086-35119108 TCCATCCAATGTTAGATAAAAGG - Intergenic
1066781026 10:38944536-38944558 TTATCCTGAGGTTAGAAAAATGG - Intergenic
1066953861 10:42147589-42147611 TTATCCTGAGGTTAGAAAAATGG + Intergenic
1069315593 10:67096876-67096898 TCATCTAAATTTTAGATATATGG + Intronic
1069347945 10:67492044-67492066 TCATCCAATTGTTAGATTAAAGG + Intronic
1070503048 10:77089483-77089505 TAATCCTCTTTTTAGATAAAAGG - Intronic
1071948774 10:90678764-90678786 TCAAACTAATGTTAAATACATGG + Intergenic
1072565609 10:96614354-96614376 TCATCCTAGGGTCAGATAATAGG - Intronic
1073086426 10:100892872-100892894 TCATCCTAAAATTATATAGAAGG + Intergenic
1078786695 11:14501241-14501263 TCATCTCAATGTTATATAAATGG + Intergenic
1080630977 11:34075379-34075401 CCAACCTCATGTTAGATACACGG + Intronic
1081431985 11:42986325-42986347 TCAACTTTATTTTAGATAAAGGG - Intergenic
1084803354 11:71561778-71561800 TCATCCTAGTGTTTGTGAAATGG - Intronic
1086731458 11:90255742-90255764 TGAAACTAATGTTAGATATAAGG - Intergenic
1086968581 11:93055897-93055919 TCATCCTAATTTTTCAGAAATGG - Intergenic
1088007238 11:104956983-104957005 TCTTCCTGATCTTAGAGAAAGGG - Intronic
1088179784 11:107096050-107096072 TCTTCCTAATTTAAGATAAGAGG - Intergenic
1088412204 11:109546903-109546925 TTGTACTAATGTTATATAAATGG - Intergenic
1089449189 11:118579961-118579983 CTATCCTAATATTATATAAATGG - Intronic
1090110011 11:123897395-123897417 TCAGCCTTATGATAGATAATTGG + Intergenic
1092295136 12:7191129-7191151 GGATCCCAATGTTAGATACAAGG - Intronic
1092355637 12:7792658-7792680 CCATCCTAATTTTAAAAAAAAGG + Intronic
1094172855 12:27512422-27512444 CCATCCAAATGCTACATAAATGG + Intergenic
1094687996 12:32738426-32738448 TCTTCCACAGGTTAGATAAAAGG - Intronic
1096118960 12:49074202-49074224 TCATCCTAATGTTAGATAAATGG + Intergenic
1096479800 12:51931894-51931916 GCATCCTAAACTTATATAAAAGG - Intergenic
1098574258 12:72023316-72023338 TTATCCTTATGTAATATAAATGG + Intronic
1098790999 12:74821719-74821741 ACATTCTAAAGTTAGATATATGG + Intergenic
1099115042 12:78613577-78613599 TAATCCAAATGTTTGATAAATGG - Intergenic
1099122374 12:78707480-78707502 TATTCCTAATGTAAGAGAAAAGG + Intergenic
1102019666 12:109673422-109673444 TCATCCTCATTTTACATAGAGGG - Intergenic
1102487358 12:113267204-113267226 TCATCCTCATTTTGGACAAAAGG - Intronic
1105684150 13:22761375-22761397 TCATCCTAATGTGTGTGAAATGG - Intergenic
1106849569 13:33774977-33774999 TCATCCTACAGGTAGAAAAATGG + Intergenic
1108061711 13:46539779-46539801 TCATCCTCATTTTACATATAAGG + Intergenic
1108081737 13:46744309-46744331 CCCTTCCAATGTTAGATAAAAGG + Intronic
1109759618 13:66810927-66810949 TCATATTAATATTAGGTAAAGGG - Intronic
1117723344 14:58647810-58647832 GCATCTAAATGTTGGATAAACGG - Intronic
1118019831 14:61699616-61699638 TTATGTTAATCTTAGATAAAGGG - Intronic
1119394124 14:74313304-74313326 TCATTCTAATTTTATATACAGGG - Intronic
1126816103 15:52455885-52455907 TGATCCGTATGTTAGATGAAAGG - Intronic
1127252079 15:57249954-57249976 TCATCCATATGTTAGAGAGAAGG - Intronic
1128985687 15:72219264-72219286 TGCTCCTCATGTTAGAAAAAGGG + Intronic
1130289524 15:82585145-82585167 TCTTCCTACTGTGAAATAAAGGG - Intronic
1136695984 16:32082545-32082567 TTATCCTGAGGTTAGAAAAATGG + Intergenic
1136715873 16:32280821-32280843 TTATCCTGAAGTTAGAAAAATGG - Intergenic
1136752039 16:32648944-32648966 TTATCCTGAAGTTAGAAAAATGG + Intergenic
1136771335 16:32844260-32844282 TTATCCTGAGGTTAGAAAAATGG + Intergenic
1136796477 16:33025798-33025820 TTATCCTGAGGTTAGAAAAATGG + Intergenic
1136822550 16:33331522-33331544 TTATCCTGAAGTTAGAAAAATGG - Intergenic
1136829113 16:33388061-33388083 TTATCCTGAAGTTAGAAAAATGG - Intergenic
1136834179 16:33486843-33486865 TTATCCTGAAGTTAGAAAAATGG - Intergenic
1136868224 16:33772965-33772987 TTATCCTGAGGTTAGAAAAATGG - Intergenic
1136899243 16:34017193-34017215 TTATCCTGAAGTTAGAAAAATGG - Intergenic
1137083935 16:36099428-36099450 TTATCCTGAGGTTAGAAAAATGG + Intergenic
1138943786 16:61822566-61822588 TTATCCCATTGTTAAATAAAGGG - Intronic
1140080952 16:71746852-71746874 TAATGCGAATGTCAGATAAATGG - Intronic
1140119041 16:72067563-72067585 TCATCCTGATGTTTGGTCAAGGG + Intronic
1140538602 16:75734026-75734048 TCTTCCTGATGGGAGATAAATGG + Intronic
1140644588 16:77015527-77015549 TTTTCCTAAAGTTACATAAATGG - Intergenic
1203010737 16_KI270728v1_random:237677-237699 TTATCCTGAAGTTAGAAAAATGG + Intergenic
1203054181 16_KI270728v1_random:908930-908952 TTATCCTGAAGTTAGAAAAATGG + Intergenic
1203073760 16_KI270728v1_random:1106370-1106392 TTATCCTGAGGTTAGAAAAATGG + Intergenic
1203103950 16_KI270728v1_random:1343311-1343333 TTATCCTGAGGTTAGAAAAATGG + Intergenic
1203129564 16_KI270728v1_random:1619057-1619079 TTATCCTGAGGTTAGAAAAATGG - Intergenic
1144369712 17:14578502-14578524 ACCTCCTAATGTTGGAGAAATGG + Intergenic
1145690495 17:26733674-26733696 TTATCCTGAGGTTAGAAAAATGG - Intergenic
1145710266 17:26964839-26964861 TTATCCTGAGGTTAGAAAAATGG - Intergenic
1147633838 17:41950311-41950333 TCATCCTTATTTTAGAGATAGGG + Intronic
1148377822 17:47165049-47165071 TCAGATTAATGTTATATAAATGG + Intronic
1149072797 17:52563148-52563170 TCATCCTAATTTTACAGAGAAGG + Intergenic
1149157025 17:53643481-53643503 TATTCCAAATCTTAGATAAAAGG + Intergenic
1150012981 17:61523688-61523710 TTATCCTAATTTTAGAGATAAGG - Intergenic
1151011436 17:70502327-70502349 TCATAATAATTTCAGATAAAAGG + Intergenic
1152456273 17:80418197-80418219 TCATCCTCAAGTCAGAAAAAAGG - Intronic
1153234673 18:2974629-2974651 TCTTCCTAATGTTAGTTACAGGG + Intronic
1153289511 18:3486561-3486583 TCGTCCTAATGTGTGTTAAAAGG + Intergenic
1153776349 18:8457637-8457659 TCATACTAATGTTAGACATTTGG - Intergenic
1155738662 18:29257089-29257111 TCATCATAATTTAAAATAAAGGG + Intergenic
1156174161 18:34522486-34522508 TCACACTAATAATAGATAAATGG + Intronic
1158906165 18:62014169-62014191 TTATCCCCATGTTAAATAAAAGG - Intergenic
1158919252 18:62171534-62171556 TCATCCTAATATTGGAAACAAGG - Intronic
1162592689 19:11603020-11603042 TCAGCCTAATGATAAATAGATGG - Intronic
1166249482 19:41557874-41557896 TTATCCTCATGTTAGAGATATGG + Intronic
1168573032 19:57486208-57486230 TCATGCAAATGTTAGCTTAATGG - Intergenic
1202670145 1_KI270709v1_random:42339-42361 TCATCCTGAGGTTAGAGAAATGG - Intergenic
926193712 2:10747470-10747492 TCATACTAAAGTTATATAAGAGG - Intronic
928161997 2:28936313-28936335 TCAGCAGCATGTTAGATAAATGG - Intronic
931430498 2:62205378-62205400 TTATCCAAATGTTCTATAAAAGG - Intronic
932010908 2:67976542-67976564 TCAAACTAATGTAAGCTAAAAGG - Intergenic
932427577 2:71649937-71649959 TCATCTTAATATTAGATGAGAGG + Intronic
933010539 2:77056394-77056416 TAATCATAATGTGAGATCAAGGG + Intronic
933033367 2:77360955-77360977 TCATCCTAGTCTGGGATAAATGG - Intronic
933259646 2:80117950-80117972 TCATCCTTATTTTAGAGACAGGG + Intronic
934251273 2:90358074-90358096 TTATCCTGAGGTTAGAAAAATGG + Intergenic
934258287 2:91445326-91445348 TTATCCTGAGGTTAGAAAAATGG - Intergenic
937209929 2:120261946-120261968 CCATGATAATGTTAGATAGAAGG + Intronic
937694991 2:124799018-124799040 TTTTCCTAATGCTAAATAAAAGG + Intronic
938517902 2:132036040-132036062 TTATCCTGAGGTTAGAAAAATGG + Intergenic
940298903 2:152158999-152159021 TCCTCCTATTAATAGATAAAAGG - Intronic
940460915 2:153961564-153961586 TTTTCCTAATTTTATATAAAGGG - Intronic
942079715 2:172388530-172388552 TCATCATAATGTAAAATAATGGG + Intergenic
942292333 2:174485725-174485747 TCATCCTAATCTTTTTTAAACGG + Intronic
942674833 2:178415848-178415870 TCAGCCTCATTTAAGATAAAAGG + Intergenic
943127487 2:183812869-183812891 TCATCCTAATGTCTTATTAAGGG + Intergenic
943382331 2:187166771-187166793 TTATCTTAAAGTAAGATAAAAGG + Intergenic
943516781 2:188898508-188898530 TTATCCTCATTTTAGAAAAAGGG - Intergenic
944983663 2:205150503-205150525 TTTTTTTAATGTTAGATAAAGGG + Intronic
945692947 2:213064666-213064688 TCATCGAAAGGTTGGATAAAGGG - Intronic
1169639696 20:7737018-7737040 TCATTCTAATAATATATAAACGG - Intergenic
1169898360 20:10528306-10528328 TCAAACTAATGTTTGATAAATGG - Intronic
1170679569 20:18513935-18513957 TCATCCTAATTTTAAAGACAAGG - Intronic
1173001445 20:39108736-39108758 TCTTCCTAATGTGAGATAATTGG + Intergenic
1173199303 20:40942994-40943016 TCATCCACATGGTAGATAACGGG - Intergenic
1174675368 20:52349142-52349164 TCATTCCAATATTATATAAAAGG - Intergenic
1175239013 20:57533076-57533098 TCATCCCAAGGGTTGATAAAAGG + Intergenic
1178192522 21:30301071-30301093 TAATCCGAATGTGAGATAACTGG + Intergenic
1203235833 22_KI270732v1_random:315-337 TTATCCTGAGGTTAGAAAAATGG - Intergenic
1203288930 22_KI270735v1_random:15769-15791 TTATCCTTAGGTTAGAAAAATGG + Intergenic
1203324702 22_KI270738v1_random:2960-2982 TCATCCTGAGGTTAGAAAAATGG + Intergenic
949273179 3:2245002-2245024 TCATTCTAACGTCAAATAAACGG + Intronic
950374567 3:12560131-12560153 TCATCCTAATACAAAATAAATGG - Intronic
952064924 3:29557754-29557776 TTCTCCTAATTTTGGATAAATGG + Intronic
953420864 3:42752131-42752153 TGATCCTAAAGTGAGCTAAAAGG - Intronic
953480414 3:43246687-43246709 TCATCCCAGAGTGAGATAAAGGG + Intergenic
957182226 3:76893766-76893788 TAAACATAGTGTTAGATAAAAGG - Intronic
960834503 3:121891724-121891746 CCATCTTAATATTATATAAATGG + Intergenic
963651255 3:147983211-147983233 TAATTCTGATGTTAGTTAAAAGG - Intergenic
965199900 3:165644393-165644415 TCACCCATATGTTGGATAAAAGG + Intergenic
965864857 3:173194139-173194161 TCATCCTTATGTTATAGATAAGG + Intergenic
966767608 3:183477565-183477587 TTATCCTAATGTTAGAGATAAGG + Intergenic
967202000 3:187079890-187079912 TCATACTAATGTGAGATTAGTGG + Intergenic
967362047 3:188642311-188642333 TCAGCATAATGTTAGAGAAATGG + Intronic
970257759 4:14186627-14186649 ACATGCTAATGTTAGAAGAAAGG + Intergenic
971211233 4:24618736-24618758 TCATTTTTGTGTTAGATAAAGGG + Intergenic
971713347 4:30145526-30145548 TCATTCTAATGGTTGTTAAATGG + Intergenic
972727908 4:41761756-41761778 TCATAATAATGGTAAATAAAAGG - Intergenic
979059549 4:116040149-116040171 TTATCCTAATTTTAGATAGATGG + Intergenic
979064791 4:116116522-116116544 TGATCCTGATGTTAGAGAAAAGG - Intergenic
980046562 4:127995917-127995939 TCTTCCTTATGTTAGACACAGGG - Intronic
982713165 4:158779271-158779293 TCATTATAATGTTAAATAAAAGG + Intronic
982931569 4:161414545-161414567 ATATTCTAATGTTAAATAAATGG - Intronic
983342685 4:166484792-166484814 TCAACCTAATGTGAAATTAAAGG + Intergenic
985194293 4:187411536-187411558 TCATCCTCATTTTACAGAAAAGG - Intergenic
985420430 4:189779927-189779949 TCATCCTAACTTTAAAGAAAAGG + Intergenic
985738937 5:1603421-1603443 TCATCCTCATAGTTGATAAATGG - Intergenic
986502994 5:8420212-8420234 TGAGCCTAATGTTAGATGTAAGG - Intergenic
986531195 5:8738803-8738825 TCAGCCGAATGTTATATCAAGGG + Intergenic
986558502 5:9036993-9037015 TATTCCAAATGTTAGATGAATGG - Exonic
990087629 5:51998258-51998280 TCATCCTATTGTTTGGTACAAGG + Intergenic
992954941 5:81898626-81898648 TCATCCTCATTTTACAGAAAGGG - Intergenic
993408818 5:87548588-87548610 TGTTCCTAATCTTAGAGAAAAGG + Intergenic
993557821 5:89363705-89363727 TCATCTTATTGTCAGAGAAATGG + Intergenic
993570437 5:89531360-89531382 GAATACTAATGTTAGACAAATGG - Intergenic
993794649 5:92250901-92250923 CTATCCTAATTTTAGATAGATGG + Intergenic
998295986 5:140968880-140968902 TAATGCTATTATTAGATAAAGGG - Exonic
1000206456 5:159064729-159064751 AGATTCTAATGTTAGATATATGG - Intronic
1000527921 5:162381419-162381441 TAATACTAATGATAGATGAATGG - Intergenic
1004119257 6:12804070-12804092 TCATGCTAAGGTCAGATGAATGG - Intronic
1004981530 6:21029999-21030021 TCATTCTACTGTAAGACAAATGG + Intronic
1006087411 6:31606170-31606192 TCATCCTAATGTTAGCACAACGG - Intergenic
1009486474 6:64229768-64229790 ACATCCTAATGTTAATTCAAAGG - Intronic
1010464541 6:76151425-76151447 TCTTGTTAATGTAAGATAAATGG + Intergenic
1012183662 6:96187092-96187114 CAAGCCTAATGTTAGAAAAAAGG + Intronic
1012288459 6:97422184-97422206 GCATCCTAGTGTTAGAGAAGAGG + Intergenic
1013028805 6:106309668-106309690 TCATGCTATTCTTAAATAAATGG + Intronic
1013749142 6:113381932-113381954 GCATCCATATTTTAGATAAAGGG - Intergenic
1014436052 6:121421748-121421770 TCTTCCTGATTTTAGGTAAAAGG - Intergenic
1015698386 6:136007547-136007569 TCATCCTCATTTTACACAAAGGG - Intronic
1015993737 6:138976425-138976447 CCATTCTAATGTTACTTAAAGGG - Intronic
1018233074 6:161694752-161694774 TCATCCTCATGTTAGCAAACAGG - Intronic
1018517642 6:164603173-164603195 TAATTCTAAAGTTAGATACAAGG - Intergenic
1019782326 7:2949769-2949791 TAATCCTAAAATTAGGTAAAAGG - Intronic
1020608714 7:10368446-10368468 TCATCTTGATTTTAGATAACTGG - Intergenic
1020634486 7:10680025-10680047 TCATCCTAATTTGAGTTAATAGG + Intergenic
1020839571 7:13198733-13198755 CAATCCTAGTGTTAGAAAAATGG + Intergenic
1020887417 7:13835438-13835460 TCATTCTAAGGCTACATAAATGG + Intergenic
1021506180 7:21388020-21388042 TAATCATAATTTTATATAAAAGG - Intergenic
1022194766 7:28054214-28054236 CCATCCTATTAATAGATAAATGG - Intronic
1024156898 7:46635213-46635235 TCAGCTTAATGTTCCATAAATGG + Intergenic
1024404199 7:48959386-48959408 TCATTCAAATGTAAGATCAATGG - Intergenic
1025320668 7:58089994-58090016 TTATCCTGAGGTTAGAAAAATGG - Intergenic
1028007845 7:85600103-85600125 TTATCCTAATTTTACAAAAAAGG + Intergenic
1028885264 7:95925306-95925328 TCATCAAAATGTGAGATGAAAGG + Intronic
1031928351 7:127659814-127659836 GCAACCTCATGTTAGAGAAAAGG - Intronic
1033912254 7:146278370-146278392 TCACACTGATGTTACATAAAAGG - Intronic
1033963542 7:146945197-146945219 TGATACAGATGTTAGATAAAGGG - Intronic
1034376183 7:150646590-150646612 TCAACCTAACGTCAGGTAAAAGG + Intergenic
1035349179 7:158232995-158233017 TGCTCCAAATGTTAGAGAAAAGG - Intronic
1037117476 8:15243861-15243883 TGATCTTACTGTTAGAAAAAAGG + Intergenic
1038850557 8:31271214-31271236 TTAACATAATGTTGGATAAATGG + Intergenic
1039211837 8:35225811-35225833 TCATCCTTATTTTAGTTACAGGG + Intergenic
1042427848 8:68669859-68669881 TCATCCCAGAGTTAGACAAAGGG - Intronic
1042724801 8:71861883-71861905 TCCTCCTAATCTTTGATAAATGG - Intronic
1044095630 8:88060551-88060573 TCATCCTAGTTTTCCATAAATGG - Intronic
1044149464 8:88756805-88756827 TCATCCTAAAATTAGTAAAAAGG - Intergenic
1044630841 8:94277354-94277376 TCATGCCAATGTAAGAGAAAGGG - Intergenic
1045577933 8:103446156-103446178 TCATCATATTTTTAGAGAAAAGG + Intergenic
1047110662 8:121785619-121785641 TTATCCTAATGTTTATTAAAGGG + Intergenic
1048542653 8:135356516-135356538 TCATCCTAAGCTTTGACAAAGGG + Intergenic
1052119602 9:24695453-24695475 TCCTCCTAAGATTAGAAAAAAGG + Intergenic
1056267162 9:84909139-84909161 TTATCATAATGTTATATATATGG + Intronic
1058171872 9:101691622-101691644 TCTTCCTAGTCTCAGATAAATGG + Intronic
1060440130 9:123630796-123630818 TCATCCTAATTGTATTTAAAAGG - Intronic
1061642336 9:131969046-131969068 TCATCATAATGTAGGATTAATGG - Intronic
1185864877 X:3614668-3614690 TAAACATAATGTTAGATAAAAGG + Intronic
1188122171 X:26320798-26320820 GCATCCTATAGTTAGAAAAATGG - Intergenic
1188149785 X:26657881-26657903 TGTTCCTAATCTTAGAGAAATGG + Intergenic
1189486146 X:41433785-41433807 TCATTTTAATGTTTGAAAAAAGG - Intergenic
1189532218 X:41897177-41897199 TCTTCCTAATCTTAGAAAAAAGG + Intronic
1189696190 X:43665570-43665592 TCATCTTCACTTTAGATAAAAGG - Intronic
1194372015 X:93085555-93085577 TCTTCCAGATGTTATATAAAAGG + Intergenic
1194869445 X:99110270-99110292 TAATTCTAATCTGAGATAAATGG - Intergenic
1196217124 X:113066588-113066610 TCTTCCAAATGTTAGAGAAAAGG + Intergenic
1197294667 X:124704042-124704064 TTATTCTCATTTTAGATAAATGG + Intronic
1197535595 X:127685044-127685066 TCTTCCAGATCTTAGATAAAAGG + Intergenic
1198921601 X:141734792-141734814 TTATCCTAATATTAGAGAAAAGG + Intergenic
1199931608 X:152529354-152529376 TCATCCTAATGTATTTTAAATGG + Intergenic