ID: 1096121175

View in Genome Browser
Species Human (GRCh38)
Location 12:49090335-49090357
Sequence AGGCCGGGTGGTGCCCACGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096121175_1096121182 10 Left 1096121175 12:49090335-49090357 CCGGCGTGGGCACCACCCGGCCT 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1096121182 12:49090368-49090390 CCGCCAAAACCCAGTCTCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096121175 Original CRISPR AGGCCGGGTGGTGCCCACGC CGG (reversed) Exonic
900472865 1:2863278-2863300 CGGACGGGTGGTGGCCACGGGGG + Intergenic
900547533 1:3237002-3237024 AGGCCGGATGGAGCCCACTGCGG + Intronic
902619630 1:17643411-17643433 AGGCGTGGTGGTGGCCATGCTGG - Intronic
904534054 1:31187581-31187603 AGGCCGTGTGGTGCCGCAGCAGG + Intronic
905016839 1:34783621-34783643 GGGCAGGGTGGTGGCCTCGCAGG + Intronic
906094942 1:43216527-43216549 AGGCCTGAAGGTGCCCAAGCTGG + Intronic
906203030 1:43972010-43972032 AGGCCTGGAGGTGGCCAGGCAGG - Exonic
906238888 1:44229426-44229448 AGGCTGGGTGGGGGCCAGGCTGG + Intronic
910773222 1:90850972-90850994 AGGCAGGCTGGGGCCCAGGCCGG + Intergenic
911219847 1:95234577-95234599 GGGCCTGGGGGTGCGCACGCAGG - Intronic
915276620 1:154793279-154793301 AGGAGGGGTGGTGCACAAGCTGG - Intronic
921974376 1:221186243-221186265 AGACAGGGTGTTGCCCAAGCTGG + Intergenic
924801230 1:247331026-247331048 AGGGCGGGCGGGGCCCACCCCGG - Intronic
1062861443 10:813516-813538 AGTCCGGATGCTGCCCACACTGG + Intronic
1063137835 10:3232491-3232513 AGTCCTCGTGGTGCCCACGGAGG + Intergenic
1064657657 10:17571969-17571991 AGGCAGGGTCTTGCCCACACTGG - Intergenic
1067205377 10:44207959-44207981 AGGCATGATGGTGCCCACCCTGG + Intergenic
1067682700 10:48450706-48450728 AGGCCCGGCGGTGTCCGCGCAGG + Exonic
1067808708 10:49410550-49410572 AGGCCTGGCAGTGCCCAGGCTGG - Intergenic
1068311510 10:55283009-55283031 AGGCAGTGTGGTCCCCAGGCAGG - Intronic
1069721623 10:70553530-70553552 AGTCCGAGAGGTGCCCATGCTGG + Intronic
1073292773 10:102421533-102421555 AGGCGGGGCGGTACCCAGGCAGG - Intronic
1073931339 10:108580239-108580261 AGGCAGGCTGGTCCCCAGGCAGG - Intergenic
1076761572 10:132608510-132608532 AGACAGGCTGGTGCCCTCGCAGG + Intronic
1077412874 11:2411565-2411587 CAGCCGGGTGGGGCCCAGGCAGG + Intronic
1084268111 11:68015230-68015252 CGGCTGGGTGGTGCCCATGAAGG + Intronic
1084421700 11:69063686-69063708 AGGCCTGGTCGTGCCCTGGCAGG - Intronic
1085025961 11:73236763-73236785 TGGCAGGGTGGTGCTCAGGCTGG + Intergenic
1090036331 11:123252719-123252741 AGGACAGGTGGTGCCCACAGTGG + Intergenic
1091581572 12:1793642-1793664 AGGCTGGGTGGTGTCACCGCAGG + Exonic
1095446441 12:42287417-42287439 AGGAAGAGTGGTCCCCACGCTGG - Intronic
1096121175 12:49090335-49090357 AGGCCGGGTGGTGCCCACGCCGG - Exonic
1096241164 12:49961250-49961272 AGGCCGGGAGCGGCCCACGTCGG + Intergenic
1096522425 12:52191825-52191847 AGGCCGGGGGCTGCCCACCGGGG + Exonic
1100329461 12:93570777-93570799 AGGGCGGGCGGTGTGCACGCCGG - Intronic
1100978119 12:100142918-100142940 AGGCGGGGCGGGGCCAACGCCGG + Intergenic
1101954545 12:109201650-109201672 AGGCTGCGTGGTGGCCAGGCTGG + Exonic
1102887519 12:116533342-116533364 AGTCGGGGCGGGGCCCACGCCGG - Intergenic
1103642501 12:122363302-122363324 AGACGGGGTGTTGCCCAGGCTGG - Intronic
1104281394 12:127381229-127381251 AGACCGGGTTGTGGCCGCGCCGG - Intergenic
1104904572 12:132206257-132206279 GGCACAGGTGGTGCCCACGCCGG + Intronic
1106100033 13:26686633-26686655 TGGCCGGCTGGTGCCCACACTGG - Exonic
1106411996 13:29517054-29517076 AGGCCCGGCTGAGCCCACGCAGG + Intronic
1110556844 13:76869544-76869566 AGGCTGGGAGGTGCACATGCTGG - Intergenic
1111833410 13:93357803-93357825 AGGCAGGCTGTTGCCCAGGCTGG - Intronic
1113656749 13:112072567-112072589 AGGCCGGGAGGTGGGGACGCAGG + Intergenic
1113802235 13:113092644-113092666 AGGCCGGGTGATGGCCAGGAAGG - Intronic
1113808313 13:113122695-113122717 AGGCAGGGGAGTGACCACGCTGG - Intergenic
1113866656 13:113530959-113530981 AAGCTGGGTGGTGCCCAGGTTGG + Intronic
1117377637 14:55130019-55130041 AAGCCGGGTCATGCCCACTCAGG - Intronic
1119029752 14:71182792-71182814 AGGCAGGTAGGTGCCCACGGCGG + Intergenic
1119420108 14:74503291-74503313 AGGTGGTGCGGTGCCCACGCAGG + Exonic
1122459813 14:101885341-101885363 AGGCAGGGTGCTCCCGACGCAGG - Intronic
1122459835 14:101885427-101885449 AGGCAGGGTGCTCCCGACGCAGG - Intronic
1122517037 14:102316109-102316131 AGGCTGGGTGGTGGACACGGTGG + Intergenic
1122738986 14:103859901-103859923 AGGCCGTTGGGTGCCCACCCAGG - Intergenic
1122764280 14:104054765-104054787 AGGCCAGGTGGGCCACACGCAGG + Intergenic
1122886510 14:104712770-104712792 ACCCCGGGTGGTGCCCGCGCGGG + Intronic
1123831171 15:24139178-24139200 AGGCAGGTTGGTGTCCACACAGG + Intergenic
1123836122 15:24194904-24194926 AGGCAGGTTGGTGTCCACACAGG + Intergenic
1123871527 15:24579611-24579633 AGGCAGGTTGGTGTCCACGTAGG + Intergenic
1124004660 15:25786114-25786136 AGGCAAGGTCGTGCCCAGGCGGG + Intronic
1124879214 15:33626038-33626060 AGGGCTGCTGGTGCCCAAGCAGG + Intronic
1125542331 15:40476743-40476765 AGACAGGGTGTTGCCCAGGCTGG + Intergenic
1128067620 15:64774845-64774867 AGGCGGGGTCCTGGCCACGCAGG + Intronic
1129394517 15:75236617-75236639 AGGCCGGCTGGAGCCAAAGCTGG + Intergenic
1129795799 15:78375044-78375066 AGGGCAGCTGGTGCCCACACAGG + Intergenic
1130679691 15:85985641-85985663 AGGCCAGGTGCTGCCCTCGTGGG - Intergenic
1131061190 15:89405695-89405717 AAGGCGGGAGGTGCCCGCGCGGG + Intergenic
1132663815 16:1072850-1072872 AGGGCAGGGGGTGCCCGCGCGGG - Intergenic
1135812283 16:25599105-25599127 AGACAGGGTGTTGCCCAGGCAGG + Intergenic
1139885730 16:70205422-70205444 AGACGGGGTGGTGGCCAGGCAGG - Intergenic
1141576222 16:84965057-84965079 TGAGCGGGTGGTACCCACGCGGG - Intergenic
1141639415 16:85332852-85332874 AGGCCGTGTGCTGGCCACCCAGG + Intergenic
1141645824 16:85367040-85367062 CGGCAGGGTGGTGGCCAGGCGGG - Intergenic
1141840021 16:86568217-86568239 GGGCCTGGTGGTGCCGCCGCTGG + Exonic
1142610528 17:1107310-1107332 AGGCCCGCTGGGGCCCACGAAGG - Intronic
1143021517 17:3919259-3919281 AGGCCGGCTGGAGCCCTCGAGGG + Intergenic
1143461762 17:7108651-7108673 AGGCGGGGTGGAGCACAAGCTGG - Intronic
1144663258 17:17085201-17085223 AGCCCGGGAGGTGCCTACACAGG - Intronic
1147211582 17:38875219-38875241 AGACTGGGTGGTGACCAGGCTGG + Intronic
1147582017 17:41632288-41632310 AGGCCTGGTGCTGCCTACGAGGG - Intergenic
1149996719 17:61409640-61409662 AGGCCGGGCGGCGCCGGCGCGGG + Intergenic
1150282899 17:63939842-63939864 AGCCCTGGTGGTGCTCACGGAGG + Exonic
1152231771 17:79117488-79117510 AGGCTGGGGGCTGCCCCCGCAGG + Intronic
1152424053 17:80209439-80209461 AGGCCGAGGGGTGTCCAGGCCGG + Exonic
1152628090 17:81397475-81397497 GGGCCGGGGGCTGCGCACGCGGG - Intronic
1152778620 17:82216743-82216765 ATGCAGGCTGGTGCCCAGGCGGG - Intergenic
1152782111 17:82231185-82231207 AGGCTGGGCGGGGCCCACCCGGG - Intronic
1153912654 18:9717922-9717944 AGACCGGGTCTTGCCCAGGCTGG + Intronic
1153922478 18:9804028-9804050 AGCCCGGGAGGTGGCCATGCTGG + Intronic
1156042794 18:32842764-32842786 AGGCTGAGTGGGGCCCAGGCTGG - Intergenic
1160152545 18:76406122-76406144 AGGCCGGGCGGTGCCTCCGGAGG - Intronic
1160199424 18:76783781-76783803 AGGCCGAGGGGTGGCCAGGCGGG + Intergenic
1160673422 19:376947-376969 AGGCTGGGTGGGGCACACGGGGG - Intergenic
1160696041 19:484962-484984 AGGCCCCGTGGTGCCCACCTGGG - Intergenic
1160991213 19:1861060-1861082 AGGCCTGGGGGTGCCCAGTCGGG - Intronic
1161481469 19:4512877-4512899 AGTCTTGGTGGTGTCCACGCCGG + Exonic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162738989 19:12763242-12763264 AGGGTGGGTGGAGCCCAGGCTGG + Exonic
1162760801 19:12887140-12887162 TGGCTGGCTGGTGCCCACCCTGG + Exonic
1163594381 19:18212368-18212390 AGACGGGGTGTTGCCCAGGCTGG + Intronic
1164713419 19:30375224-30375246 AGGCCGAGCGCTGCCCCCGCCGG + Intronic
1165316746 19:35060575-35060597 AGGGCGGATTGTGCCCAGGCAGG + Intronic
1166843469 19:45712621-45712643 AGGCCTGGTTGTGCCTACCCTGG - Exonic
1166924612 19:46258783-46258805 AGGCAGGGTGGCACCCAGGCTGG + Intergenic
1167909464 19:52690094-52690116 AGGCTGGGAGGTGCCCACGGCGG + Intronic
1168353821 19:55690334-55690356 AGGCCGTGTGCTGCACACCCAGG + Intronic
1168384765 19:55953942-55953964 AGGCGTGGTGGTGCACACGCCGG - Intronic
925108390 2:1312476-1312498 AGGCTGCCTGGTGCCCACCCAGG - Intronic
927941987 2:27110205-27110227 AGACAGGGTGTTGCCCAGGCTGG - Intronic
929603646 2:43220277-43220299 AGGCCTGGTGGGCCCGACGCAGG - Intergenic
931625234 2:64251216-64251238 AGGCTGTGTGGTTCTCACGCGGG + Intergenic
932484414 2:72074430-72074452 AGCCTGGGTGCTGCCCACACTGG - Intergenic
933741598 2:85538626-85538648 AGGCCGTGAGGAGCCCTCGCTGG + Intergenic
935566263 2:104610853-104610875 AGGCATGGTGGTGCCCACCTGGG + Intergenic
937354139 2:121187540-121187562 AGGCTGGGTGATGCACACCCTGG + Intergenic
948219467 2:236258176-236258198 AGGCAGGGTGTGGCCCACACAGG + Intronic
948460731 2:238128787-238128809 CGACGGGCTGGTGCCCACGCGGG + Exonic
1171968329 20:31547405-31547427 AGGCCGCGTGGCGCCCGCGCCGG + Intronic
1172343378 20:34177375-34177397 AGGCGGGGTCTTGCCCAGGCTGG + Intergenic
1174246822 20:49188072-49188094 GGGCCTGGTGGGGCCCTCGCGGG - Intronic
1175247580 20:57591066-57591088 AGGCCCGGTGGGGACCAAGCCGG + Intergenic
1175762959 20:61573576-61573598 TGGCCCTGGGGTGCCCACGCTGG - Intronic
1179192680 21:39136773-39136795 AGGCCGGATGGCCCCCACTCAGG + Intergenic
1182623533 22:31630566-31630588 AGCCCGGGCCGTGCCCACGTGGG + Intronic
1183373819 22:37450677-37450699 AGGGCGGGTGGTGGCCATGATGG - Intergenic
1184414096 22:44342149-44342171 CGGCTGGCTGGTGCCCACACAGG - Intergenic
1184833498 22:47006562-47006584 AGGCCGGATGGCGGCCACCCAGG + Intronic
1184912837 22:47547643-47547665 TGGCCGGATGTTGCCCAGGCTGG - Intergenic
1185004820 22:48269790-48269812 AGGCAGGCTGGTGGCCAGGCTGG - Intergenic
1185372603 22:50467989-50468011 AGGCCTGGTGGTGCAGATGCTGG - Intronic
950482663 3:13254306-13254328 TGGCCAGGAGGTGCCCAGGCTGG + Intergenic
950613277 3:14139503-14139525 AGGCTGGGTGGGGCCAACTCTGG + Intronic
953783663 3:45894344-45894366 GGGCTGGGTGGTGCCCACTGGGG - Intronic
955226292 3:57063160-57063182 AGGCCCTGAGGTGCCCACGCAGG + Intronic
956787590 3:72655369-72655391 AGGCCCGGCGGTGCTCACGGGGG - Intergenic
961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG + Exonic
962784501 3:138754239-138754261 AGACAGGGTGTTGCCCAGGCTGG - Intronic
964475078 3:157090746-157090768 AGGCCTGGAGGTGCCCACTGGGG + Intergenic
967192627 3:186998049-186998071 AGACAGGGTGTTGCCCAGGCTGG - Intronic
968810535 4:2797760-2797782 TGCCCTGGTGGTGCCCACGTGGG + Intronic
969277132 4:6143510-6143532 AGGCCAGGTGGGACCCAGGCCGG - Intronic
972608730 4:40637393-40637415 AGGCAGGGTGGCACCCACTCAGG + Intergenic
973554171 4:52065694-52065716 AGCCAGGGTGCTGCCCACGATGG + Intronic
976067120 4:81200510-81200532 AGGCAGACTGGTGCCCAGGCTGG + Intronic
979867100 4:125770256-125770278 AGTCAGAGTGGTGCCCAGGCTGG + Intergenic
983833275 4:172358427-172358449 AGGCCGCGTGCGGCCCAGGCTGG + Intronic
985110288 4:186541050-186541072 AGGCAGGGTGGTGGGAACGCAGG - Intronic
985573320 5:662271-662293 AGGTCGGGTGGTGCCCGGGCCGG + Exonic
985629743 5:1008402-1008424 GGGCCGGGGGGGGCCAACGCTGG + Intergenic
992095196 5:73356650-73356672 TGCCCTGGTGGTGCCCATGCAGG - Intergenic
1002294413 5:178222400-178222422 AGGCTGGGTTGCGGCCACGCAGG + Exonic
1002567728 5:180121025-180121047 ATGCCAGGTGGTGCCCACCCTGG + Intronic
1003109182 6:3239321-3239343 AGGCAGTGTGGTGCCCACTCAGG - Intronic
1003152991 6:3568550-3568572 AGGCTGGGTAGTGGCCACCCAGG + Intergenic
1006450570 6:34103636-34103658 AGGCCGGGAGGAGCCCAGGCAGG + Intronic
1015843059 6:137493538-137493560 AGGCCGGATGGTGCCGATGGCGG + Exonic
1016885377 6:148955055-148955077 AGGCCCGGAGGTTCCCAGGCTGG - Intronic
1016932269 6:149423008-149423030 AGATGGGGTGCTGCCCACGCTGG - Intergenic
1017022173 6:150149033-150149055 AGGCAGGCTGTTGCCCAGGCTGG - Intronic
1018755811 6:166849076-166849098 AGGCCTGGGGCTGCCCAGGCTGG - Intronic
1019423491 7:962621-962643 CAGCCGGGTGGTTCACACGCAGG - Intronic
1022936759 7:35186282-35186304 AGGCGGGGTGCTGCGCGCGCTGG - Intergenic
1023875420 7:44283895-44283917 TGGCCTGGTGGGGCCCAGGCTGG - Intronic
1025977495 7:66380359-66380381 AGACAGGGTGTTGCCCAGGCTGG - Intronic
1031434524 7:121715775-121715797 AGACAGGGTGTTGCCCAGGCTGG + Intergenic
1034196557 7:149252774-149252796 GGTCCTGGTGGTGCCCACCCAGG + Exonic
1035125630 7:156606823-156606845 AGGTAGGGTGGTGCCCAGGCGGG - Intergenic
1035125658 7:156606898-156606920 AGGCCGGGTGGTCCCCTGGTGGG - Intergenic
1037882462 8:22579710-22579732 GGGCAGGGTGGTGCCCAGCCTGG + Intronic
1041101376 8:54399218-54399240 AGGAGAGGTGGTGCCCAGGCTGG + Intergenic
1045388147 8:101690416-101690438 AGGCCGGGTGCTGCCCTTGGAGG - Intronic
1048975890 8:139672862-139672884 GGGCAGGGTGGAACCCACGCAGG - Intronic
1049156894 8:141072810-141072832 AGGCAGGGTGGTGACTACGGGGG + Intergenic
1057579474 9:96273627-96273649 AGGCATGGTGGTGCCAAGGCTGG - Intronic
1060028943 9:120197662-120197684 AGGCCGGCTGAGGCCCAGGCTGG - Intergenic
1187859329 X:23666480-23666502 AAGCGGGGCGGTGCCCACGGCGG + Intronic
1194947831 X:100090663-100090685 AGGCCGGATGATGCCCACCTGGG + Intergenic