ID: 1096121185

View in Genome Browser
Species Human (GRCh38)
Location 12:49090378-49090400
Sequence GGGAACTGCACCGCGGAGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096121185_1096121191 6 Left 1096121185 12:49090378-49090400 CCAGTCTCCGCGGTGCAGTTCCC 0: 1
1: 0
2: 0
3: 0
4: 73
Right 1096121191 12:49090407-49090429 CTTTCCGCTCGCCGCTCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1096121185_1096121195 26 Left 1096121185 12:49090378-49090400 CCAGTCTCCGCGGTGCAGTTCCC 0: 1
1: 0
2: 0
3: 0
4: 73
Right 1096121195 12:49090427-49090449 AGGCGCACAGTTGCATTTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096121185 Original CRISPR GGGAACTGCACCGCGGAGAC TGG (reversed) Exonic
900113522 1:1019551-1019573 GGGAGCTGCGGCGCGGAGGCGGG - Intergenic
900298967 1:1967284-1967306 GGGAACTGGGCCGGGTAGACAGG + Intronic
1066220849 10:33335466-33335488 GGGAGCCGCACCGCGAAGCCGGG + Intronic
1069544478 10:69318766-69318788 GGGGACGGGAGCGCGGAGACCGG + Intronic
1072188074 10:93060929-93060951 GGGAGGTGCCCCGCGGAGCCGGG + Intergenic
1082816709 11:57514361-57514383 GGAAGCTGCAGCGCGCAGACAGG - Intronic
1082941646 11:58711348-58711370 GAGAACTGAACAGAGGAGACAGG - Intronic
1092799691 12:12152111-12152133 GGGAACAGCACGGGGAAGACCGG - Intronic
1093102746 12:15047626-15047648 GGAAACTGCTCCTAGGAGACAGG + Intergenic
1095419976 12:42015350-42015372 GGGAACAGCACCAAGGAGTCTGG - Intergenic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1100809269 12:98322495-98322517 GGGAACTGCTCCGCTGATAGTGG - Intergenic
1102964214 12:117113602-117113624 GGGACCTGCCCCCAGGAGACAGG - Intergenic
1103507778 12:121453286-121453308 GCCAACTTCACCGCGGAGGCCGG + Exonic
1103596971 12:122030066-122030088 GGGAACTGCACCCCTGATTCAGG - Intronic
1103984637 12:124759178-124759200 GGGAAGGGCACCCTGGAGACTGG - Intergenic
1104957728 12:132474627-132474649 GGGAAGGGCACCGCGGAGGGAGG - Intergenic
1108063459 13:46554100-46554122 GGGAACTCCAGCGCGGACAGCGG + Intronic
1114250443 14:20955514-20955536 AGGAGCTACAGCGCGGAGACTGG + Exonic
1123467601 15:20528288-20528310 GGAAACTGCCCCGCTGAGGCTGG - Intergenic
1123650513 15:22472754-22472776 GGAAACTGCCCCGCTGAGGCTGG + Intergenic
1123740921 15:23281596-23281618 GGAAACTGCCCCGCTGAGGCTGG + Intergenic
1123746077 15:23320962-23320984 GGAAACTGCCCCGCTGAGGCTGG - Intergenic
1124278346 15:28344279-28344301 GGAAACTGCCCCGCTGAGGCTGG - Intergenic
1124304356 15:28567329-28567351 GGAAACTGCCCCGCTGAGGCTGG + Intergenic
1130211817 15:81930887-81930909 GTGAACTGCACGTGGGAGACAGG + Intergenic
1143456673 17:7072280-7072302 GGTAACTGGACGGCGGAGGCAGG - Intergenic
1148770822 17:50064901-50064923 GGGAACTGCAAGGAGGAGAAAGG + Intronic
1152950010 17:83223939-83223961 GGGAAATGTAGCGGGGAGACGGG - Intergenic
1157394496 18:47330577-47330599 GGGAACTGAAGCACAGAGACGGG - Intergenic
1161271048 19:3389464-3389486 GGGTGCTGCACTGGGGAGACAGG + Intronic
1162031123 19:7917674-7917696 GGGAAGTGCCACGCTGAGACTGG - Intronic
1163418502 19:17201389-17201411 GGGAGCTGCACAGCGGGCACAGG + Intronic
1163592923 19:18204414-18204436 GGGAACCGCCCCTCGAAGACCGG - Intergenic
1165069924 19:33249216-33249238 GGGAACTGAGCCTCGGAGAGGGG + Intergenic
1165957081 19:39507668-39507690 GCCAACTGCACCACGGAGATGGG - Intronic
1168524229 19:57075959-57075981 GGAAACTGCATCGAGGAGATGGG - Intergenic
925146680 2:1587223-1587245 GGAACCTGCACAGTGGAGACCGG + Intergenic
933716334 2:85363825-85363847 GAGAACAGCACAGCAGAGACTGG + Intronic
940851485 2:158691513-158691535 GGGAAGAGCAGCGCGGAGATGGG - Intergenic
945502448 2:210592900-210592922 TGGAACTGCACAGCGAAGAAGGG - Exonic
949014745 2:241702638-241702660 GGGGACTGCGGCGCGGAGGCGGG + Intronic
1173594240 20:44248262-44248284 GTGAACTGCACCCCTCAGACAGG + Intronic
1175291720 20:57880485-57880507 GGGAACTGCACCGGGAACCCAGG - Intergenic
969490967 4:7499002-7499024 GGGGGCAGCACCGTGGAGACGGG + Intronic
969536064 4:7756732-7756754 GGGGACTGCGCCGAGGAGCCGGG + Intergenic
974975054 4:68881243-68881265 GGGAACTGCAGGGAGGAGAAGGG - Intergenic
977930983 4:102748566-102748588 GGGAACTGGACCTAGAAGACAGG + Intronic
981286231 4:143022329-143022351 GGGAACTGCACAGTGGTTACTGG - Intergenic
997523489 5:134538126-134538148 GTGAGCTGCCCTGCGGAGACTGG + Intronic
1011626646 6:89288519-89288541 GAGAACTGCACAGCTGAGCCCGG + Intronic
1016588389 6:145715716-145715738 GTGAACTGCACTTGGGAGACAGG + Intronic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1020005746 7:4783099-4783121 GGGAGCTGCATCGCTGAGGCTGG - Intronic
1037609345 8:20463378-20463400 GGGAACTTCACTGGGGAGAGTGG + Intergenic
1038575404 8:28700514-28700536 AAGAACTGCACCCCAGAGACAGG - Intronic
1042246406 8:66712812-66712834 GGGAGCAGCACCGCGGGGCCAGG + Intronic
1048315501 8:133358920-133358942 AGGAACTGCACAGTGGATACTGG + Intergenic
1048967559 8:139625434-139625456 GGGATCTGCACAGCTGAGTCAGG - Intronic
1055024305 9:71703126-71703148 GGGGACTGCTCCACGGAGCCAGG + Intronic
1055257757 9:74392624-74392646 GGGAAATCCACAGCAGAGACTGG + Intergenic
1058904401 9:109469970-109469992 GGGGACTGCGCCACGGAGAAGGG - Intronic
1060781165 9:126414389-126414411 CGGAACTGCCCGGAGGAGACAGG - Intronic
1061725976 9:132582274-132582296 GGCATCAGCACCGCGGAGAGCGG - Exonic
1061860733 9:133467530-133467552 GGAATCTCCACCGCGGAGAGGGG - Intronic
1192363556 X:70453762-70453784 GGGAGCTGCGCAGGGGAGACCGG + Exonic
1193295583 X:79828246-79828268 AGGATCTGCACCCAGGAGACAGG + Intergenic
1196683933 X:118495362-118495384 GGGCACTGCAGCTCGGAGGCGGG + Intergenic
1201857952 Y:18566225-18566247 GGAAACTGCCCAGCAGAGACAGG + Intronic
1201875369 Y:18754156-18754178 GGAAACTGCCCAGCAGAGACAGG - Intronic
1202169082 Y:22021837-22021859 GGAAACTGCCCAGCAGAGACAGG - Intergenic
1202222279 Y:22564531-22564553 GGAAACTGCCCAGCAGAGACAGG + Intergenic
1202320836 Y:23631130-23631152 GGAAACTGCCCAGCAGAGACAGG - Intergenic
1202549931 Y:26038926-26038948 GGAAACTGCCCAGCAGAGACAGG + Intergenic