ID: 1096121191

View in Genome Browser
Species Human (GRCh38)
Location 12:49090407-49090429
Sequence CTTTCCGCTCGCCGCTCCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096121183_1096121191 13 Left 1096121183 12:49090371-49090393 CCAAAACCCAGTCTCCGCGGTGC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1096121191 12:49090407-49090429 CTTTCCGCTCGCCGCTCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1096121186_1096121191 -1 Left 1096121186 12:49090385-49090407 CCGCGGTGCAGTTCCCGCAGCCC 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1096121191 12:49090407-49090429 CTTTCCGCTCGCCGCTCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1096121181_1096121191 16 Left 1096121181 12:49090368-49090390 CCGCCAAAACCCAGTCTCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1096121191 12:49090407-49090429 CTTTCCGCTCGCCGCTCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1096121185_1096121191 6 Left 1096121185 12:49090378-49090400 CCAGTCTCCGCGGTGCAGTTCCC 0: 1
1: 0
2: 0
3: 0
4: 73
Right 1096121191 12:49090407-49090429 CTTTCCGCTCGCCGCTCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1096121180_1096121191 29 Left 1096121180 12:49090355-49090377 CCTGACGCATCGGCCGCCAAAAC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1096121191 12:49090407-49090429 CTTTCCGCTCGCCGCTCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1096121184_1096121191 7 Left 1096121184 12:49090377-49090399 CCCAGTCTCCGCGGTGCAGTTCC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1096121191 12:49090407-49090429 CTTTCCGCTCGCCGCTCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096121191 Original CRISPR CTTTCCGCTCGCCGCTCCAC AGG Exonic
904812340 1:33171568-33171590 CTTTGTGCTGGCCGCTCCAGGGG + Intronic
911227275 1:95319744-95319766 GTTGCCGCTAGCAGCTCCACAGG - Intergenic
920771769 1:208893129-208893151 TTTTCCTCTCCCTGCTCCACTGG + Intergenic
1067139949 10:43648590-43648612 CATCCCGCTCTCCGGTCCACGGG + Exonic
1069445737 10:68471779-68471801 CTCTCCGCTCACAGCTCCGCCGG + Exonic
1070741457 10:78906020-78906042 CCTGCCGCTCGCCATTCCACAGG - Intergenic
1075762882 10:124870147-124870169 CTTCCCGCTCACCGCCTCACTGG + Intergenic
1077339452 11:2019539-2019561 CCTTCCTCTCACAGCTCCACAGG + Intergenic
1202822437 11_KI270721v1_random:74728-74750 CCTTCCTCTCACAGCTCCACAGG + Intergenic
1092264455 12:6970336-6970358 CTGTCCCCGCGCCCCTCCACGGG - Intronic
1096121191 12:49090407-49090429 CTTTCCGCTCGCCGCTCCACAGG + Exonic
1101008921 12:100430213-100430235 CCTTCAGCCCGCCGCTGCACTGG + Intergenic
1101080143 12:101173435-101173457 CTTACCGCTGGCCACACCACAGG - Intronic
1103377546 12:120469022-120469044 CTTCCCGCTCGCCTCTCCCCCGG - Intronic
1106512196 13:30421800-30421822 CTTTCCCCACTCCGCTCCCCGGG - Intergenic
1113452369 13:110420231-110420253 CTGTCCTCTCTCCTCTCCACTGG + Intronic
1118616734 14:67579185-67579207 CTTCCCGCTCCCCGGTCCGCAGG - Exonic
1124368043 15:29087915-29087937 CCTTTTGCTCGCCCCTCCACTGG + Intronic
1133121606 16:3611923-3611945 CCGTCCACTCTCCGCTCCACAGG - Intronic
1136566541 16:31073775-31073797 ACTTCCGCTCGCCGCGCCACCGG - Intronic
1142600254 17:1050405-1050427 CTTTCTGCTCCCTGCTCCTCTGG - Intronic
1143548400 17:7614170-7614192 CTTGGCGCTCCCCGCTCCGCAGG - Intronic
1144960450 17:19041527-19041549 CTTTCAGCTGGCTGCGCCACTGG - Intronic
1144974710 17:19132997-19133019 CTTTCAGCTGGCTGCGCCACTGG + Intronic
1151343014 17:73484085-73484107 CTCACCGCTCCCCGCTCCTCCGG + Intronic
1152239794 17:79155317-79155339 CTTTCCCCTCCCCGCTCCTCGGG + Intronic
1153887412 18:9478891-9478913 CTTTCCGCCTGCCGCGCCCCAGG - Intronic
1155854191 18:30811721-30811743 CTTCCTGCTCTCCACTCCACTGG - Intergenic
1163667743 19:18611025-18611047 CTTTCCGCTCACCCCCCCAGCGG + Intronic
927794122 2:26033764-26033786 CCTCCCGCTCCCCGCTCCCCGGG - Intergenic
945466138 2:210171808-210171830 GCTTTCGCCCGCCGCTCCACAGG + Intergenic
1176591594 21:8654686-8654708 CTTCCAGCTCCCCACTCCACAGG - Intergenic
1180274440 22:10631798-10631820 CTTCCAGCTCCCCACTCCACAGG - Intergenic
965914791 3:173830293-173830315 CTTTCCTCTCTCTGCTTCACTGG - Intronic
968734071 4:2286146-2286168 CTGTCCTCTCGCCGCTTCTCTGG - Intronic
985315552 4:188655734-188655756 CTCTCGGCTCACTGCTCCACAGG + Intergenic
1024957074 7:54933394-54933416 CTCTCTGCTCGCCTCTCCCCCGG - Intergenic
1026582375 7:71629171-71629193 CTTGCCACTGGCCACTCCACAGG - Intronic
1031085547 7:117298639-117298661 CTGTCCCCTCTCCTCTCCACAGG - Intronic
1038583668 8:28771065-28771087 CTTTCAGCTCGCAGATTCACTGG - Exonic
1039412007 8:37362734-37362756 CTTTCCCCTCACCCCTCGACAGG - Intergenic
1039843464 8:41309395-41309417 CTTCCTGCTCGCCGCACCTCCGG - Exonic
1047149188 8:122241474-122241496 CCTTCCTCTCACAGCTCCACTGG - Intergenic
1049000230 8:139821229-139821251 CTTTTCGCTGGCTGCTCCAGAGG - Intronic
1054715754 9:68556400-68556422 CTTTCTGCTCACCTCTCCATTGG + Intergenic
1057983072 9:99681742-99681764 CTTTCTTCTCACAGCTCCACTGG + Intergenic
1061045070 9:128160438-128160460 CCTTCCGCTCCCGCCTCCACCGG - Exonic
1197262455 X:124333370-124333392 GTTTCCCCAGGCCGCTCCACTGG + Intronic