ID: 1096121195

View in Genome Browser
Species Human (GRCh38)
Location 12:49090427-49090449
Sequence AGGCGCACAGTTGCATTTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 86}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096121188_1096121195 5 Left 1096121188 12:49090399-49090421 CCGCAGCCCTTTCCGCTCGCCGC 0: 1
1: 0
2: 1
3: 13
4: 195
Right 1096121195 12:49090427-49090449 AGGCGCACAGTTGCATTTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 86
1096121186_1096121195 19 Left 1096121186 12:49090385-49090407 CCGCGGTGCAGTTCCCGCAGCCC 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1096121195 12:49090427-49090449 AGGCGCACAGTTGCATTTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 86
1096121192_1096121195 -7 Left 1096121192 12:49090411-49090433 CCGCTCGCCGCTCCACAGGCGCA 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1096121195 12:49090427-49090449 AGGCGCACAGTTGCATTTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 86
1096121189_1096121195 -1 Left 1096121189 12:49090405-49090427 CCCTTTCCGCTCGCCGCTCCACA 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1096121195 12:49090427-49090449 AGGCGCACAGTTGCATTTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 86
1096121185_1096121195 26 Left 1096121185 12:49090378-49090400 CCAGTCTCCGCGGTGCAGTTCCC 0: 1
1: 0
2: 0
3: 0
4: 73
Right 1096121195 12:49090427-49090449 AGGCGCACAGTTGCATTTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 86
1096121184_1096121195 27 Left 1096121184 12:49090377-49090399 CCCAGTCTCCGCGGTGCAGTTCC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1096121195 12:49090427-49090449 AGGCGCACAGTTGCATTTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 86
1096121187_1096121195 6 Left 1096121187 12:49090398-49090420 CCCGCAGCCCTTTCCGCTCGCCG 0: 1
1: 0
2: 3
3: 10
4: 110
Right 1096121195 12:49090427-49090449 AGGCGCACAGTTGCATTTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 86
1096121190_1096121195 -2 Left 1096121190 12:49090406-49090428 CCTTTCCGCTCGCCGCTCCACAG 0: 1
1: 0
2: 0
3: 17
4: 407
Right 1096121195 12:49090427-49090449 AGGCGCACAGTTGCATTTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096121195 Original CRISPR AGGCGCACAGTTGCATTTCC CGG Exonic
900890832 1:5448568-5448590 GGACCCACAGGTGCATTTCCAGG - Intergenic
905532214 1:38689160-38689182 CAGCCCACAGTTTCATTTCCAGG - Intergenic
905703216 1:40035006-40035028 AGGAACACAGATGCATTTCACGG - Intergenic
906649974 1:47506008-47506030 TGGGAAACAGTTGCATTTCCTGG + Intergenic
908293005 1:62687500-62687522 AGGCGCACAGTTAAATTCACAGG + Intronic
909559409 1:76992871-76992893 ATGCACACACTTGCATTTGCAGG + Intronic
919397145 1:197065173-197065195 AGGGGCACAGTTGCTTGTCAGGG + Intronic
919767535 1:201136866-201136888 AGAAGCAAAGTTGCATTTACTGG - Intronic
921736905 1:218638920-218638942 AGTAGCAGAGATGCATTTCCTGG - Intergenic
922542086 1:226427295-226427317 AGGCCCACTGTTGCACATCCTGG + Intergenic
1062866306 10:858152-858174 AGGCCCACAGTTAAAATTCCAGG + Intronic
1065800547 10:29347581-29347603 TGGCCCACAGTAGCAATTCCAGG - Intergenic
1071117660 10:82241864-82241886 AGCTGCTCAGTAGCATTTCCTGG + Intronic
1074680215 10:115898486-115898508 AGGCACACAGTAGCACTGCCAGG - Intronic
1075282910 10:121156002-121156024 ATGTGCAGAGTTGCAATTCCTGG - Intergenic
1077350424 11:2090682-2090704 ATGCGCACACTTGTATGTCCAGG + Intergenic
1080255032 11:30281141-30281163 TGGCTCTCAGTTGCATTTCTGGG - Intergenic
1084621596 11:70274216-70274238 AGGAGCACAAATGCACTTCCTGG - Intronic
1089515772 11:119030577-119030599 AGCCGCACAGTAGCGTGTCCTGG - Exonic
1089616863 11:119699674-119699696 AGACGCTCAGGTGCATTCCCTGG + Intronic
1092514672 12:9197079-9197101 AGGCTCACAGTTGCAAGTCCTGG + Exonic
1093852705 12:24060332-24060354 AAGCGCATAGGTGCAATTCCTGG - Intergenic
1096121195 12:49090427-49090449 AGGCGCACAGTTGCATTTCCCGG + Exonic
1097895951 12:64824977-64824999 AGAAGCGCAGCTGCATTTCCCGG + Exonic
1104967075 12:132513189-132513211 AGGCCCACAGCTGCATCTTCTGG - Intronic
1105723260 13:23136742-23136764 ATGCTCACAGATTCATTTCCAGG + Intergenic
1115503417 14:34069904-34069926 AGGCTCACAATTACATTTCATGG + Intronic
1122247018 14:100410491-100410513 AGTTGCACAGTGGTATTTCCTGG + Intronic
1129308531 15:74687083-74687105 TGGCTCACAGTTGTAATTCCAGG + Intronic
1130663745 15:85852146-85852168 AGGTGCACAGTTTTATTTCTGGG + Intergenic
1137559601 16:49494191-49494213 AGGCACACTGTGGCTTTTCCTGG - Intronic
1137608486 16:49802985-49803007 TGGCTCACACTTGCAATTCCAGG + Intronic
1142399220 16:89850564-89850586 GGGCGCACAGGCGCATTACCAGG + Exonic
1143323203 17:6081088-6081110 AGGCGCTCAGCTGCATTTGGGGG + Intronic
1144738980 17:17570700-17570722 AGGGGAAAAGTTCCATTTCCTGG + Intronic
1145016795 17:19404132-19404154 TGGCGCACAGTTGTAATCCCAGG + Intergenic
1150134417 17:62688213-62688235 GGGCGCACAGTGGCCTTTCTGGG + Intronic
1151502693 17:74501751-74501773 AGGCTTACAGCTGCATTCCCTGG + Intergenic
1154929514 18:20977895-20977917 AGACACAAAGCTGCATTTCCTGG - Intronic
1156766144 18:40658013-40658035 AGAAGCACAGTTGCTTTTCAGGG + Intergenic
1158162199 18:54497521-54497543 TGCCTCACAGTTTCATTTCCTGG + Intergenic
1158170585 18:54594964-54594986 AGGCTCACAGTTCCATATGCTGG + Exonic
1159221061 18:65463601-65463623 AGGCCCACAGTCGGATTTCAGGG - Intergenic
1160187285 18:76685631-76685653 TGGCGCACACTTGGTTTTCCAGG + Intergenic
1166332894 19:42088921-42088943 AGCCCAACAGTTTCATTTCCCGG + Intronic
1166871778 19:45875522-45875544 AGGTGCACAGTTGTGTTTCTGGG - Intergenic
1167669399 19:50841209-50841231 AGGGGCACACTGGCATTTTCTGG - Intergenic
934501216 2:94861680-94861702 AGGCGGACAGGGGCAGTTCCTGG + Intergenic
937508043 2:122559231-122559253 ATACCCACAGTTGGATTTCCTGG - Intergenic
938063322 2:128268350-128268372 AGTCGTACAGCTGCATGTCCAGG + Exonic
938721607 2:134071971-134071993 TGGTGCACACTTGCAATTCCAGG - Intergenic
1170831034 20:19840717-19840739 ATCCACACAGTTCCATTTCCTGG + Intergenic
1175573691 20:60043522-60043544 AGGGGAAGAGTAGCATTTCCAGG + Intergenic
1179359465 21:40692168-40692190 ACGCGGACAGTCGCCTTTCCAGG + Intronic
1181540876 22:23572760-23572782 AGGCCCAGAGTAGGATTTCCAGG + Intergenic
1181550786 22:23638122-23638144 AGGCCCAGAGTAGGATTTCCAGG + Intergenic
1181797496 22:25320573-25320595 AGGCTCAGAGTAGGATTTCCAGG - Intergenic
1182121110 22:27787583-27787605 TGGGGCACACTTGCATTTCAAGG + Intronic
951599118 3:24353593-24353615 AGGCTCAGTGTTGCATTGCCAGG + Intronic
954353098 3:50061874-50061896 AGGCGCACAGTTCCCTTTTAGGG - Intronic
961045744 3:123706722-123706744 AGGCACACTGCTACATTTCCAGG - Intronic
965120011 3:164542206-164542228 AGGTGCACATTTGCATTTTCAGG + Intergenic
975836289 4:78425507-78425529 ATGCGCACTGTTACATTTCATGG + Intronic
986822887 5:11487579-11487601 GAGTGCACAGTTACATTTCCAGG + Intronic
990167157 5:53007203-53007225 AGGCAATCAGTTGGATTTCCAGG + Intronic
996552898 5:124748252-124748274 AGTGACACAGTTGCATATCCTGG - Intronic
1003162853 6:3650912-3650934 AGGCGCGCAGTGTCATGTCCAGG - Intergenic
1008412706 6:51199127-51199149 AGGTGCTCAGATGCAGTTCCAGG + Intergenic
1019095191 6:169574105-169574127 TGGCGCGCAGCTGCAGTTCCTGG + Intronic
1021663402 7:22945532-22945554 AGAAGCAAAGTTGTATTTCCAGG + Exonic
1023521581 7:41055193-41055215 AGGCTCACTTTGGCATTTCCAGG + Intergenic
1026055282 7:66978345-66978367 AGGTGCACAATTACATTTCAGGG - Intergenic
1026722419 7:72843488-72843510 AGGTGCACAATTACATTTCAGGG + Intergenic
1030682811 7:112450877-112450899 ATGTACACATTTGCATTTCCAGG + Intronic
1034098554 7:148431747-148431769 AGGAGGACAGGTGCAGTTCCTGG - Intergenic
1034202443 7:149290949-149290971 AGGCTAAAAGTGGCATTTCCAGG + Intronic
1042530587 8:69810984-69811006 AGGCCCATATCTGCATTTCCAGG + Intronic
1044780105 8:95735033-95735055 AGTCCCACAGTTGCATTTGAAGG + Intergenic
1046284196 8:112073947-112073969 AAGGGCAGAGTTGCTTTTCCTGG - Intergenic
1049477405 8:142803190-142803212 AGGCTCAAAGATGCCTTTCCAGG - Intergenic
1049766540 8:144357878-144357900 AGGCGCCCAGTTGGAGTCCCAGG - Intronic
1049955974 9:693430-693452 AGGCTTACAGCTGCATTTCTAGG + Intronic
1053217898 9:36288135-36288157 AGGTGCACAGTTTCATTTGTTGG - Intronic
1056460494 9:86805460-86805482 CAGCCCACAGTTGGATTTCCAGG - Intergenic
1058038351 9:100277551-100277573 AGGAGCACATATGCATTTCGTGG + Intronic
1060302878 9:122386024-122386046 TGGCTCACACTTGCAATTCCAGG + Intronic
1061344171 9:130008805-130008827 AGAGGCACAGTTGGTTTTCCAGG - Intronic
1194406642 X:93504268-93504290 AAGCACACAGTGGAATTTCCTGG + Intergenic
1200415553 Y:2906357-2906379 AGACTCACAGATGGATTTCCAGG + Intronic