ID: 1096121935

View in Genome Browser
Species Human (GRCh38)
Location 12:49094075-49094097
Sequence TTTCCCTTGTCACCAGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 1, 1: 0, 2: 11, 3: 98, 4: 522}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096121935_1096121939 25 Left 1096121935 12:49094075-49094097 CCTGGGGCTGGTGACAAGGGAAA 0: 1
1: 0
2: 11
3: 98
4: 522
Right 1096121939 12:49094123-49094145 TGAAGCTGGACTCACCCACCTGG 0: 1
1: 0
2: 1
3: 14
4: 151
1096121935_1096121938 11 Left 1096121935 12:49094075-49094097 CCTGGGGCTGGTGACAAGGGAAA 0: 1
1: 0
2: 11
3: 98
4: 522
Right 1096121938 12:49094109-49094131 AAACTCTCTGTAGGTGAAGCTGG 0: 1
1: 0
2: 1
3: 3
4: 143
1096121935_1096121940 26 Left 1096121935 12:49094075-49094097 CCTGGGGCTGGTGACAAGGGAAA 0: 1
1: 0
2: 11
3: 98
4: 522
Right 1096121940 12:49094124-49094146 GAAGCTGGACTCACCCACCTGGG 0: 1
1: 0
2: 1
3: 16
4: 221
1096121935_1096121937 2 Left 1096121935 12:49094075-49094097 CCTGGGGCTGGTGACAAGGGAAA 0: 1
1: 0
2: 11
3: 98
4: 522
Right 1096121937 12:49094100-49094122 TCTAAGGCTAAACTCTCTGTAGG 0: 1
1: 0
2: 0
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096121935 Original CRISPR TTTCCCTTGTCACCAGCCCC AGG (reversed) Intronic
900772233 1:4554407-4554429 TCTTCCTTGTCTCCAGCCTCGGG + Intergenic
901205462 1:7492430-7492452 ATGCCCCTGCCACCAGCCCCCGG + Intronic
901410842 1:9082912-9082934 TTCCCCCTGCCCCCAGCCCCTGG - Intronic
901814989 1:11788836-11788858 TTTCCCTGCTTGCCAGCCCCGGG + Exonic
902136900 1:14314833-14314855 TCTCCCTTCTCCCCAGTCCCTGG + Intergenic
902352420 1:15867146-15867168 TCTCCTTTGTCTTCAGCCCCTGG + Intronic
902355729 1:15898367-15898389 TCTCCCTTTCCCCCAGCCCCTGG + Intronic
903451056 1:23453895-23453917 TTTCCTGTGTCACCAACCCCTGG + Intronic
903549869 1:24150495-24150517 TTCCTCTTGGCACCAGCACCTGG - Intergenic
903902505 1:26658322-26658344 ATTCCCTTACCCCCAGCCCCTGG - Intergenic
904913771 1:33954794-33954816 TTTCCCTCTCCCCCAGCCCCTGG - Intronic
905415908 1:37804052-37804074 TGTCCCTGCTCACCAGCCTCTGG - Intronic
905449668 1:38048005-38048027 ATTCCCTTTTCAGCAGCTCCAGG - Intergenic
905469789 1:38183121-38183143 TGACCATGGTCACCAGCCCCTGG - Intergenic
905505925 1:38479580-38479602 TTCCCCTTCTCCCCAGCCCCTGG - Intergenic
905591895 1:39171429-39171451 TTCCCCTTCTCCCCAACCCCTGG + Intronic
905688950 1:39928673-39928695 TTTTCCATGACACCAGTCCCTGG + Intergenic
905732563 1:40306662-40306684 TTTCCCTTCTCAACAGGCCTTGG - Intronic
905905264 1:41613813-41613835 ATTCCCTTCCCTCCAGCCCCTGG + Intronic
905918254 1:41700672-41700694 TTTCCCTTGGCTCCTGGCCCAGG + Intronic
906087292 1:43147217-43147239 TTTCCCTTCTCTCCAGCCCCTGG - Intronic
906478279 1:46184441-46184463 TCGCCCTTGACACCAGGCCCTGG + Intronic
906801773 1:48744214-48744236 TTTCCTTTGTCCCCAGCACCTGG + Intronic
907713083 1:56902647-56902669 TTCCTCTTGCCCCCAGCCCCTGG + Intronic
907870615 1:58439287-58439309 TTCCACTGGTCACCACCCCCAGG + Intronic
908075163 1:60509334-60509356 TTTCCCATCTCACCAACCCTTGG + Intergenic
908415647 1:63910894-63910916 CATCCCTTCTCACCAGCCCTGGG + Intronic
908572212 1:65421210-65421232 TTTCCATTGACACCCGCCCGCGG - Intronic
909721105 1:78770914-78770936 TTTCTCCTGTAACCAGCCTCCGG - Intergenic
910660718 1:89669265-89669287 TTTCCCCTCCCCCCAGCCCCTGG - Intronic
910664659 1:89711296-89711318 GTTCCCTTGTCACCAGCTCGTGG + Intronic
910862290 1:91753608-91753630 TTTCCCCTCCCATCAGCCCCTGG + Intronic
911309183 1:96272319-96272341 TTTCCCTACTCCCCAGCCCCTGG + Intergenic
911810420 1:102270188-102270210 TTTACCTTTTCACCAGCAACAGG + Intergenic
912998006 1:114551122-114551144 TTTCCCATTTCCCCAGCCCCTGG + Intergenic
913538418 1:119796050-119796072 TTTCCCTTTTCTCCAGGCCACGG + Intronic
913959848 1:143330448-143330470 TTTCCCTTGCCTCCAACCCCTGG - Intergenic
914054207 1:144156021-144156043 TTTCCCTTGCCTCCAACCCCTGG - Intergenic
914124939 1:144810340-144810362 TTTCCCTTGCCTCCAACCCCTGG + Intergenic
914215714 1:145626213-145626235 TTTGCCCTGTCAGCAGCCCTGGG - Intronic
914467660 1:147946598-147946620 TTTGCCCTGTCAGCAGCCCTGGG - Intronic
914797928 1:150937316-150937338 TTTCCCCTCCCTCCAGCCCCTGG - Intronic
915103691 1:153518748-153518770 TTCCCCCTCTCTCCAGCCCCTGG - Intergenic
915772797 1:158446628-158446650 TTTCCCTTGTCATCAGTGCATGG + Intergenic
915978240 1:160404565-160404587 TTTCCCCTTACCCCAGCCCCTGG + Intronic
917002765 1:170378075-170378097 TTTCCCCTTTCCCCAGCCCCTGG + Intergenic
917123976 1:171669848-171669870 TCTCCCTAGTCACCGGCCCTTGG + Intergenic
917927095 1:179798500-179798522 TTCACCTTATCACCTGCCCCTGG + Intronic
918092420 1:181308923-181308945 TTCCCCCTGTCCCCAGCCCCTGG - Intergenic
918349771 1:183642951-183642973 GTTCCCTGCTCCCCAGCCCCTGG + Intronic
920005566 1:202831176-202831198 ATTCCCCTTTCCCCAGCCCCTGG - Intergenic
921158952 1:212459566-212459588 TTTCCCCTTCCCCCAGCCCCTGG + Intergenic
921411642 1:214842423-214842445 TTCCCCTTCCCCCCAGCCCCTGG + Intergenic
922212977 1:223499672-223499694 TTTCCCCTCCCTCCAGCCCCTGG - Intergenic
922305173 1:224338155-224338177 TTTCCCCTCTTCCCAGCCCCTGG + Intergenic
922874070 1:228926235-228926257 TTTCCCTCCTCACAAGCCTCAGG - Intergenic
923011094 1:230088247-230088269 CTCCCATTCTCACCAGCCCCTGG + Intronic
923177142 1:231477712-231477734 TTTCCCCTCTCCCCAGTCCCTGG - Intergenic
923475333 1:234326296-234326318 TTTCCCCTCTCCCCAGCCACTGG - Intergenic
924037728 1:239953941-239953963 TTTCCCTTGTTACCTCCCCAGGG + Intergenic
924210379 1:241759879-241759901 TTCCCCTTCTCTCCAGCTCCTGG + Intronic
924496084 1:244590593-244590615 TCTCCCTTTCCCCCAGCCCCTGG + Intronic
924697114 1:246412024-246412046 TTCCCCTTGTCACCTCTCCCTGG + Intronic
1062763098 10:42284-42306 TTTCCCTTCCCCCCATCCCCTGG - Intergenic
1063074920 10:2705455-2705477 TTTCCCCTCACCCCAGCCCCTGG + Intergenic
1063350164 10:5346952-5346974 TTTTCTTTGTCACCAGTCACGGG - Intergenic
1064106971 10:12508478-12508500 TTTCCCTTCCCCCCAGTCCCTGG - Intronic
1065117362 10:22495780-22495802 TTCCCCTTGTCTCCAGCCCCTGG + Intergenic
1065878587 10:30019604-30019626 TTTTCCTTCACCCCAGCCCCTGG - Intronic
1066693935 10:38061367-38061389 TTTCTCTTCTCATCAGCACCTGG - Intronic
1066998884 10:42587805-42587827 TTTCTCTTCTCATCAGCACCTGG + Intronic
1067028259 10:42862539-42862561 TTTCCCTTGCACCCAGCCCCCGG - Intergenic
1067407709 10:46038103-46038125 ATCCCCTTCTCCCCAGCCCCTGG - Intronic
1069747626 10:70725941-70725963 TTTCCCTTTTCTCCAGATCCTGG + Intronic
1069820253 10:71223085-71223107 TTTTCCTTGTCACCAAGCCAGGG + Intronic
1070058434 10:72957332-72957354 TTCCCCTTTTCCCCAGCCCCTGG + Intergenic
1070304401 10:75231044-75231066 TTTCCATTGTGACCAGCAGCAGG + Exonic
1070691218 10:78527878-78527900 TCTCCCCTCTCCCCAGCCCCTGG + Intergenic
1072073561 10:91945448-91945470 TTCCCCCTTTCCCCAGCCCCTGG + Intronic
1072338372 10:94421177-94421199 TTCCCCCTGTGACCACCCCCTGG + Intronic
1072623151 10:97093927-97093949 TCTCCCTTGTCACCAGCCTAAGG - Intronic
1072955652 10:99885674-99885696 GTTCCCTACTCACCAGGCCCAGG + Exonic
1072976109 10:100060075-100060097 TTTCCCCTTACCCCAGCCCCTGG - Intronic
1073088638 10:100913144-100913166 TTCCCCTCATCCCCAGCCCCGGG + Exonic
1074470780 10:113724841-113724863 TTCCCCTTCCCTCCAGCCCCTGG + Intronic
1075200439 10:120398713-120398735 TTTCCCCTCCCACTAGCCCCTGG - Intergenic
1075200718 10:120401530-120401552 TCTGCCTTCTCATCAGCCCCAGG - Intergenic
1075926410 10:126254985-126255007 TCGCCCCGGTCACCAGCCCCCGG + Intronic
1075941247 10:126392079-126392101 AGTTCCTTGTCCCCAGCCCCAGG - Intergenic
1076304112 10:129451397-129451419 TTCCCCTTCTCCCCAGCCCCTGG - Intergenic
1076606380 10:131692288-131692310 TTTCACTTCTCACCACCTCCTGG + Intergenic
1077270718 11:1678323-1678345 CCTCCCTGGTCCCCAGCCCCAGG - Intergenic
1078356767 11:10637884-10637906 TTTAGCTTGGCACCTGCCCCTGG - Intronic
1078551789 11:12286184-12286206 TTTCCCTTGGAACCAGGCCAAGG + Intronic
1080367464 11:31592075-31592097 TTCCCCTTCTCTCCTGCCCCTGG - Intronic
1080456887 11:32426984-32427006 CTTCCCTTGACGTCAGCCCCGGG + Intronic
1080495919 11:32818895-32818917 TTTCCCATTCCCCCAGCCCCTGG - Intergenic
1081516834 11:43840543-43840565 TTCCCCTTCCCTCCAGCCCCTGG + Intronic
1082126614 11:48439336-48439358 TTCCCCTTTTCCCCAGTCCCTGG + Intergenic
1082560186 11:54610283-54610305 TTCCCCTTTTCCCCAGTCCCTGG + Intergenic
1082800738 11:57413000-57413022 GTTCTCCTGTCAGCAGCCCCTGG - Intronic
1084011041 11:66348479-66348501 TTTTCCGTGCCACCAACCCCTGG - Intronic
1084515088 11:69633521-69633543 TCCCCCTTTTCCCCAGCCCCTGG - Intergenic
1084560129 11:69900445-69900467 TTACCTATGTGACCAGCCCCAGG + Intergenic
1085704869 11:78778073-78778095 GTCCCCTTGTCTCCAGACCCTGG + Intronic
1086461562 11:87010929-87010951 TTTCCCCTGCCCCCAGCCCCTGG - Intergenic
1087062042 11:93988613-93988635 TTTCCCTTGCCCCCAGCCCCTGG - Intergenic
1088484478 11:110327674-110327696 TTTCCCCTCTCCCCAGCCCCTGG - Intergenic
1088613027 11:111597082-111597104 TCTCCCTTCCCCCCAGCCCCAGG - Intergenic
1089679504 11:120111384-120111406 TCTCCCGTCTCAACAGCCCCAGG - Exonic
1090146563 11:124329695-124329717 TTTTCCCTCCCACCAGCCCCTGG - Intergenic
1090885796 11:130875337-130875359 TTTCCCCTCCCACCAGCCTCTGG - Intergenic
1091006824 11:131961128-131961150 CTTCCCTTGACAGCAACCCCAGG - Intronic
1091660456 12:2379448-2379470 TCTTCCTTGTCCCCAGCCCCAGG - Intronic
1092149833 12:6240170-6240192 TTTCCCTTCTCCCTAGCCTCTGG - Intergenic
1092165459 12:6339939-6339961 TTTCCCTTTCCTCCAGCTCCAGG + Intronic
1095783696 12:46087380-46087402 TTTCCCATGACACCAGCCCCAGG - Intergenic
1096121935 12:49094075-49094097 TTTCCCTTGTCACCAGCCCCAGG - Intronic
1096379028 12:51139720-51139742 TTTCCCTTGCCCCCAGGCCTTGG + Intronic
1096437191 12:51603177-51603199 TTTCCCTAATCCCCAGCCCCTGG + Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097218751 12:57434482-57434504 TGTCCCTTTCCACCATCCCCAGG + Intergenic
1097703427 12:62843894-62843916 TTACCTTTGTCCCCAGACCCAGG + Intronic
1098529103 12:71520384-71520406 TTCCCCTTATTTCCAGCCCCTGG - Intronic
1098594026 12:72250132-72250154 TTGCTCTTTTCCCCAGCCCCAGG - Intronic
1098799141 12:74931191-74931213 TTCCCCTTGTGCCCAGACCCTGG + Intergenic
1100047745 12:90404249-90404271 TTCCCCTTTTCCCCAGCCCCTGG - Intergenic
1100771595 12:97928898-97928920 TTCCCCTTGTCCCCTTCCCCTGG + Intergenic
1101295671 12:103421173-103421195 TCTCCCTTGTCATTAGCCCCTGG - Intronic
1101340519 12:103838937-103838959 TCTCCCTTGTCCCCAATCCCTGG - Intronic
1101492386 12:105221789-105221811 TCTGCCTTGGCAACAGCCCCGGG - Intronic
1101810304 12:108102145-108102167 CCTTCCTTGTCACCAGCCCCTGG - Intergenic
1101935316 12:109052448-109052470 TTTCCCTTAGCAACAGGCCCCGG - Intronic
1102358335 12:112260123-112260145 TTCCCCTTGCCCCCAGCCCCCGG + Intronic
1103431213 12:120888634-120888656 TTACCCTTCTCCCCAGCCCTTGG - Intronic
1103496922 12:121370158-121370180 TTTCCCCTCTCCCCAGCCCCTGG + Intronic
1104003394 12:124874901-124874923 TTTCCCTCTCCCCCAGCCCCTGG - Intronic
1105236219 13:18555802-18555824 TTTCCCTTGTCACAAGCCTGGGG - Intergenic
1105826103 13:24125093-24125115 TTTCCTTTCTCTCCAACCCCTGG + Intronic
1105975750 13:25470945-25470967 TTTCTCTCTTCCCCAGCCCCAGG - Intronic
1106111164 13:26778394-26778416 TTCCCCCTCCCACCAGCCCCTGG + Intergenic
1106338196 13:28803807-28803829 TTCCCCCTGCCCCCAGCCCCTGG + Intergenic
1106593833 13:31120501-31120523 ATTTCCTTCTCCCCAGCCCCTGG - Intergenic
1106797435 13:33221242-33221264 TTTCCCTATTCGCCAGCCCCTGG + Intronic
1107491647 13:40885427-40885449 TCTCCCCTACCACCAGCCCCTGG + Intergenic
1107598860 13:41992132-41992154 TTCCCCTTCACCCCAGCCCCTGG + Intergenic
1108432717 13:50370473-50370495 TTCCCCTTTTTGCCAGCCCCTGG - Intronic
1108452432 13:50580635-50580657 TCTCTCTTTTCCCCAGCCCCTGG + Intronic
1108492282 13:50993608-50993630 TTCCCTTTGTCTCCAGGCCCTGG + Intergenic
1109080179 13:57889101-57889123 TTTCCCTTTCCCCCACCCCCTGG - Intergenic
1109191704 13:59332251-59332273 TTCCCCCTTTCCCCAGCCCCTGG + Intergenic
1109346772 13:61124592-61124614 TTTCCCTTTACCCCAGTCCCTGG - Intergenic
1109490020 13:63085483-63085505 TTTCCCTTGCTACCAACACCAGG - Intergenic
1111224420 13:85251272-85251294 TTTCTCTTGTCAGCAGGCACTGG - Intergenic
1111443632 13:88315113-88315135 TTTCCCTTTTCCCTGGCCCCTGG + Intergenic
1111483081 13:88857952-88857974 TTTCACTTTTCCCTAGCCCCCGG - Intergenic
1112059262 13:95721063-95721085 TAACCCTTTACACCAGCCCCTGG + Intronic
1112163715 13:96895644-96895666 TTTCCCTTGTGGCCACACCCAGG - Intergenic
1112178819 13:97055969-97055991 TTTCCCATTTCCCCAGCCCCTGG - Intergenic
1112395559 13:99027510-99027532 GTTCCCTTATCCCCAGCCTCTGG - Intronic
1112641680 13:101282491-101282513 TACCCCCTGTCCCCAGCCCCTGG - Intronic
1112714295 13:102165852-102165874 TTTCCCTTTCCTCCAGCCTCTGG - Intronic
1113602419 13:111579600-111579622 CTTCCCTGGCCCCCAGCCCCTGG + Intergenic
1114202332 14:20533840-20533862 TTCCCCCTTTCCCCAGCCCCTGG + Intergenic
1115177744 14:30584021-30584043 TTTTCCGTGTCCCCAGCCCCTGG + Intronic
1116553902 14:46278778-46278800 TTTCCCTTCCCTCCAGCCCCTGG + Intergenic
1117741938 14:58827834-58827856 CATTCCTTGTCACCAGCACCAGG + Intergenic
1118127753 14:62927716-62927738 TTCCCCTTTTCTTCAGCCCCTGG - Intronic
1118501662 14:66367944-66367966 TTTCCCTAGGCTCAAGCCCCTGG + Intergenic
1118776768 14:68978548-68978570 TTTCCCTTTTCTTCCGCCCCTGG - Intronic
1118789678 14:69078733-69078755 TTTCCCCTGCCACTAGGCCCTGG - Intronic
1118807406 14:69250250-69250272 TTTCTCTTGTCCCTAGCCCCTGG + Intergenic
1121367685 14:93329775-93329797 TTTCCCTTACCCCCAGCCCCTGG - Intronic
1121569033 14:94932681-94932703 TTTTCCTTATTCCCAGCCCCGGG + Intergenic
1121820529 14:96962192-96962214 CTTCCTTTGTCCCCAGCCCTGGG - Intergenic
1122017030 14:98804974-98804996 TTTCCCCTCTCACCAGCCCCTGG - Intergenic
1122295364 14:100702605-100702627 TCTCCCCTCTCTCCAGCCCCTGG + Intergenic
1122971353 14:105153542-105153564 TTTCCCCAGCCAGCAGCCCCAGG + Intronic
1123451668 15:20368195-20368217 TTTCCCTCTCCCCCAGCCCCTGG - Intergenic
1123580319 15:21709259-21709281 ATGCCCCTGACACCAGCCCCTGG - Intergenic
1123616967 15:22151882-22151904 ATGCCCCTGACACCAGCCCCTGG - Intergenic
1124414520 15:29464041-29464063 TCTCCCTTCTCCCCGGCCCCTGG - Intronic
1124475523 15:30030288-30030310 TTTCCCTTCTCCCCAGCTTCTGG + Intergenic
1125477249 15:40055582-40055604 TTGCCCATGTCCCCAGCCCCGGG + Intergenic
1126319470 15:47406605-47406627 TTTCCCTACTCTCCAGACCCTGG - Intronic
1126965197 15:54044079-54044101 TTTCCCCTGCCCCCAGCCTCTGG + Intronic
1127733059 15:61817908-61817930 GCTCCCTTCACACCAGCCCCGGG + Intergenic
1127964417 15:63913185-63913207 TTTCCCCTTTCCCTAGCCCCTGG - Intronic
1128081346 15:64858927-64858949 TTGCCCCTCTCCCCAGCCCCTGG + Intronic
1128269971 15:66300379-66300401 TTCCCCTTGACCCCAGCCCCCGG - Intronic
1128307653 15:66610573-66610595 TTTCAATTGTCAACAGACCCAGG - Intronic
1128425640 15:67539694-67539716 TTCCCCTTCCCTCCAGCCCCTGG - Intergenic
1129319407 15:74765955-74765977 TCCCCCTTCTCCCCAGCCCCAGG - Intergenic
1130554484 15:84913250-84913272 AGTGCCCTGTCACCAGCCCCAGG - Intronic
1131097862 15:89667230-89667252 CTTCCCTCCCCACCAGCCCCAGG + Intronic
1131192448 15:90327423-90327445 TTTCCCCTGTCCCCAGCCCCCGG - Intergenic
1131216893 15:90545006-90545028 GTTCCCTTCCCACCAGCCTCTGG + Intronic
1131359082 15:91773331-91773353 TTTCCCCTCTCCCCAGACCCTGG - Intergenic
1131432806 15:92400298-92400320 TATCCTTTATCTCCAGCCCCTGG + Intronic
1202989189 15_KI270727v1_random:443504-443526 ATGCCCCTGACACCAGCCCCTGG - Intergenic
1132800754 16:1751718-1751740 TGCCCCTCGTCCCCAGCCCCAGG + Intronic
1132880833 16:2161063-2161085 GTTCCCTGGCCTCCAGCCCCAGG + Intronic
1133896392 16:9933278-9933300 CTTCCCTTGCAAGCAGCCCCTGG + Intronic
1134027428 16:10965039-10965061 TTTCCCTCCTCCCCAGTCCCTGG + Intronic
1135274617 16:21101685-21101707 TTTCCATTGTCCCCAGCCTGGGG - Intronic
1136004439 16:27318960-27318982 ATTCCCGTGTCCCCAGCCCCTGG - Intronic
1136278577 16:29193712-29193734 TGTCCCTTGTCACCAGCGGTGGG + Intergenic
1136652107 16:31681897-31681919 ATTGCCTGGCCACCAGCCCCTGG + Intergenic
1136671732 16:31864674-31864696 ATTGCCTGGCCACCAGCCCCTGG + Intergenic
1138639081 16:58368557-58368579 TTTCCCCTCTCCCCAGCCCCTGG + Intronic
1138766065 16:59605816-59605838 TTTCCCTCTTCTCCAGCCCCTGG - Intergenic
1139162124 16:64522950-64522972 TTTTCCTACTCCCCAGCCCCTGG + Intergenic
1139375244 16:66492862-66492884 TGTCCCTCGGCACCAGCCCTTGG + Intronic
1139555186 16:67703847-67703869 TTACCCATGTGCCCAGCCCCTGG + Intronic
1139592245 16:67939806-67939828 TTTCACTCCTCACCAGCCACAGG - Exonic
1140732639 16:77870554-77870576 CTTCCTGTGTCCCCAGCCCCGGG - Intronic
1142082965 16:88159793-88159815 TGTCCCTTGTCACCAGCGGTGGG + Intergenic
1142698721 17:1647084-1647106 GTTGCCTTCTCTCCAGCCCCGGG - Intronic
1142982014 17:3677839-3677861 TTTCCCTGGACACCTGCTCCAGG + Intronic
1143184163 17:5000503-5000525 TTTCCCGTGTTCCCAGTCCCTGG + Intronic
1143677870 17:8449555-8449577 TTTCCCTTCCCTTCAGCCCCTGG + Intronic
1143783056 17:9239558-9239580 TTTCCCTTCTCCCCAGGCTCAGG + Intronic
1144517653 17:15929852-15929874 TTTCCCCTTCCCCCAGCCCCTGG - Intergenic
1144543015 17:16163975-16163997 TTCCCCTTTTCCCCAACCCCTGG - Intronic
1144579077 17:16447855-16447877 GCTTCCTTTTCACCAGCCCCCGG + Exonic
1144582700 17:16468547-16468569 CTTCCCTTCCCCCCAGCCCCTGG - Intronic
1145213086 17:21029867-21029889 TTCTCCCTGTCCCCAGCCCCTGG - Intronic
1145301449 17:21642315-21642337 TTCCCCCTTTCCCCAGCCCCTGG + Intergenic
1146259561 17:31412664-31412686 CTCCTCTTGTCCCCAGCCCCTGG + Intronic
1146447080 17:32940816-32940838 CATTCCTTGTCACCAGCACCAGG - Exonic
1147199973 17:38794309-38794331 TTTCCCCCGCCCCCAGCCCCTGG - Intronic
1147645130 17:42028750-42028772 TTTCCCTGGGCTCCAGCTCCTGG + Intronic
1148325647 17:46782061-46782083 TTTCCCTGGGCCGCAGCCCCTGG - Intronic
1148750183 17:49941054-49941076 GTCCCCTTGCCACCAGCACCAGG - Intergenic
1148835576 17:50464060-50464082 TGTCCCTGGACACCAGCCCAGGG + Intronic
1148909305 17:50932164-50932186 TTTTGCTTCTCACCAGCCCATGG - Intergenic
1149262964 17:54899684-54899706 TCTCCCTAGTCACCATCTCCAGG + Intronic
1149897647 17:60441372-60441394 TTTCCCCTATCCCCAGCTCCTGG + Intergenic
1150038293 17:61828390-61828412 TTTCCCTATTGTCCAGCCCCAGG - Intronic
1150141982 17:62737931-62737953 TTCTCTTTGTCACTAGCCCCAGG + Intronic
1150203995 17:63387057-63387079 TTTCCCTGGTCTCAAGCTCCTGG + Intronic
1150435157 17:65148074-65148096 TTTCCCTTCTCTCTAACCCCTGG + Intronic
1150595845 17:66603767-66603789 TTTCCCTCCCCTCCAGCCCCTGG + Intronic
1150685895 17:67320691-67320713 TTCCCCCTTTCCCCAGCCCCTGG - Intergenic
1151350788 17:73530904-73530926 TCTCCCTAATCACCAGCCCTAGG + Intronic
1151546685 17:74797668-74797690 GTTCCCTTGACCCCAGACCCTGG + Intronic
1152243715 17:79174120-79174142 TTTCCCTGGTCCCCACCACCAGG - Intronic
1152956007 18:42615-42637 TTTCCCTTCCCCCCATCCCCTGG - Intergenic
1153432490 18:5033258-5033280 TTTCCCCTCTCCCCAGCCTCTGG - Intergenic
1153615129 18:6927155-6927177 TTTCCATTGTCACTACCACCAGG - Intergenic
1153807730 18:8723975-8723997 TCTCCCCTCTCCCCAGCCCCAGG - Intronic
1154137808 18:11795911-11795933 ATTCCCATCTCACCAGCTCCAGG + Intronic
1154363996 18:13689577-13689599 TTTGCCTTGTTCCCAGCCACGGG - Intronic
1154513321 18:15134196-15134218 TTTCCCTTGTCACAAGCCTGGGG + Intergenic
1156255400 18:35391055-35391077 ATTCCCTCTTCCCCAGCCCCTGG - Intergenic
1156412693 18:36849182-36849204 TTACTCCTCTCACCAGCCCCTGG + Intronic
1157001039 18:43525478-43525500 TTTGCCTTATCACTAGCCCCGGG + Intergenic
1157137749 18:45073746-45073768 TTCCCCATCTCCCCAGCCCCTGG + Intergenic
1157345512 18:46827398-46827420 TTTCCCTTTTCACCCTCTCCAGG - Intronic
1157363750 18:47044312-47044334 TCTCCCCTGCCCCCAGCCCCTGG - Intronic
1157814665 18:50722028-50722050 CTTCCTTTGTCAGCAGCACCTGG + Exonic
1157970673 18:52264424-52264446 TTTTCCTCCCCACCAGCCCCTGG + Intergenic
1158109321 18:53922795-53922817 TTTCCATTCTCCCCAGCCCCTGG - Intergenic
1158465611 18:57687243-57687265 ATTCCCCTGACTCCAGCCCCTGG + Intronic
1158638316 18:59180528-59180550 TTTCTATTGGCACCAGCCCCAGG + Intergenic
1158819093 18:61137598-61137620 TTTCCCTCTCCCCCAGCCCCTGG + Intergenic
1159017592 18:63114426-63114448 TGCCCCTTTTCACCTGCCCCAGG + Intergenic
1159350750 18:67269476-67269498 TGTTCTTTGTCACCAGCGCCTGG + Intergenic
1160726720 19:620813-620835 TCTCCCTTCTCCCCTGCCCCAGG - Intronic
1161361626 19:3853151-3853173 AATCCCTAGTCCCCAGCCCCAGG - Intronic
1161936597 19:7376116-7376138 ATCCCCTTGTCTCCAGCCCTTGG - Intronic
1162786001 19:13035310-13035332 TTTCCCCTTTCACCTCCCCCTGG + Intronic
1163083695 19:14963289-14963311 TTTCCCTGCTCCCCAGTCCCTGG - Intronic
1163145803 19:15378954-15378976 CTGCCAATGTCACCAGCCCCAGG + Intronic
1163166646 19:15502665-15502687 TTTCAGCTGTTACCAGCCCCTGG + Intergenic
1163275455 19:16281194-16281216 TTTCCCTCGGCCCCAGCCCAGGG - Intergenic
1163295729 19:16411283-16411305 TCTCCCCTTTCTCCAGCCCCTGG - Intronic
1163830134 19:19543665-19543687 TTTTCTTTGTCCCCAGCCCCAGG + Exonic
1163845101 19:19634190-19634212 TTTCTCTTCACACCATCCCCAGG - Exonic
1164649764 19:29883151-29883173 TTCCCCCTGTCCCCAGCTCCAGG - Intergenic
1165202245 19:34154542-34154564 TTCCCCTTTCCCCCAGCCCCTGG - Intergenic
1165550669 19:36582148-36582170 TTCCCCCTGCCCCCAGCCCCTGG - Intronic
1165765758 19:38350015-38350037 TTTCTCTCTTCACCATCCCCTGG + Intronic
1166035173 19:40163050-40163072 TTTCCCTTTCCCCCAGCCCCTGG + Intergenic
1166515309 19:43442299-43442321 TTTCCCTTGTCAAGATTCCCTGG - Intergenic
1166665457 19:44677225-44677247 TTTCCCTGGCCACCAACCCCTGG - Intronic
1167178780 19:47885245-47885267 TTACCCTTCTCTTCAGCCCCTGG + Intronic
1167339082 19:48904242-48904264 AGTCCCTTGTCAGCTGCCCCAGG + Intronic
1167357649 19:49014123-49014145 TATCCCCTGGCACCAGCCCTGGG + Intronic
1167922827 19:52796207-52796229 TTCCCCCTGTCCCCAGACCCAGG - Intronic
1167955904 19:53063566-53063588 TTTGCCTTGTCCCCAACCCTGGG - Intergenic
1168500709 19:56890521-56890543 TTCCTCTTGTTCCCAGCCCCTGG + Intergenic
1202693686 1_KI270712v1_random:108700-108722 TTTCCCTTGCCTCCAACCCCTGG - Intergenic
925455107 2:4009427-4009449 TTTCACTTGTTACCATCCCCAGG + Intergenic
926311206 2:11677502-11677524 CTTCCCTTTACACCAGTCCCGGG - Intergenic
926485308 2:13448091-13448113 TTTCCCTCTCCCCCAGCCCCTGG + Intergenic
927795415 2:26043977-26043999 TTTCCCTCTTCCCCAGCCCCTGG - Intronic
927806876 2:26155817-26155839 ATTCCCTTCCCCCCAGCCCCTGG - Intergenic
928066198 2:28166749-28166771 TTTCCTTTGTTGCCAGCCCTAGG + Intronic
929121767 2:38489491-38489513 TCTCCCCTGGCCCCAGCCCCAGG - Intergenic
929166060 2:38883327-38883349 TTTCCCATCACCCCAGCCCCTGG + Intronic
929301615 2:40309980-40310002 TTTCCCTTCCCCTCAGCCCCTGG + Intronic
929435010 2:41922120-41922142 TTCCCTTTGTCACCAGCCCTTGG - Intergenic
929853656 2:45616514-45616536 TTTCCCCTTCCACCAGCACCTGG + Intergenic
930170942 2:48251118-48251140 TTCCCCCTTTCCCCAGCCCCTGG - Intergenic
930457343 2:51622253-51622275 TTTCCTTTTTCCCCAGACCCAGG + Intergenic
930709334 2:54535402-54535424 TTTTCCTTTCCCCCAGCCCCAGG + Intronic
931260427 2:60613686-60613708 TTTCCTTCCTCTCCAGCCCCTGG - Intergenic
931564909 2:63605781-63605803 GTTACCTTGTCACCAGTACCTGG + Intronic
931737127 2:65206045-65206067 TTTCCATTGTGACCAGCAGCAGG + Intergenic
932164133 2:69490645-69490667 TTTCCCCTCCCCCCAGCCCCTGG - Intronic
932652580 2:73574926-73574948 TCCCTCTTCTCACCAGCCCCCGG + Intronic
933645054 2:84805358-84805380 TTCCCCCTCTCCCCAGCCCCTGG - Intronic
933761094 2:85672649-85672671 GTTCCCTCTTCCCCAGCCCCTGG - Intergenic
933952878 2:87345879-87345901 TTTCCCTTGCCCCCAACCCCTGG + Intergenic
933990538 2:87631067-87631089 TCTCCCCTCTCCCCAGCCCCTGG - Intergenic
934237115 2:90242223-90242245 TTTCCCTTGCCCCCAACCCCTGG + Intergenic
934662422 2:96150238-96150260 TTTCCCTGGGCACCCACCCCTGG + Intergenic
935595618 2:104874996-104875018 TTTCCCCTGCCCCCAGCCCTTGG + Intergenic
935690228 2:105724555-105724577 ATTCCCTTGTCATAAGCTCCAGG - Intergenic
936303308 2:111319757-111319779 TCTCCCCTCTCCCCAGCCCCTGG + Intergenic
937154571 2:119709976-119709998 TTTCCCCTTTCCCCAGTCCCCGG - Intergenic
937438907 2:121900670-121900692 CTTCCCTGGTCCCCCGCCCCTGG - Intergenic
937688549 2:124725718-124725740 TTTCCCTACTCCCCAGCCCCTGG + Intronic
938375868 2:130806225-130806247 TTCCCCTTTTCCCCAGCCCTAGG - Intergenic
938513569 2:131978807-131978829 TTTCCCTTGTCACAAGCCTGGGG + Intergenic
938582724 2:132661720-132661742 TTTCCCCTTTTCCCAGCCCCTGG - Intronic
938611011 2:132947825-132947847 GTTTCATTGTCACCTGCCCCAGG + Intronic
940144673 2:150533571-150533593 TCTCCCTAGTCATCAGCCCCAGG + Intronic
940155161 2:150648337-150648359 TTTCCCTTTTAACCAGCCCAAGG + Intergenic
941695882 2:168550615-168550637 TTTCCCTTTTCTCCAGCCACTGG + Intronic
942053165 2:172159557-172159579 TTTCCCTTCCCTACAGCCCCTGG + Intergenic
942271228 2:174277472-174277494 TTTCCCTTTTCCCTACCCCCCGG + Intergenic
942403701 2:175630435-175630457 TTTTCCTTTTCCCCAGCCCCAGG + Intergenic
943340219 2:186671779-186671801 TCTCCCCTATCACCAGCCCCTGG + Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944593755 2:201243064-201243086 TTTCCCCCCTCCCCAGCCCCTGG - Intronic
945884110 2:215356610-215356632 TTCCCCTTCGCCCCAGCCCCTGG + Intergenic
946167758 2:217875850-217875872 GGCCCCCTGTCACCAGCCCCCGG + Intronic
946592186 2:221262788-221262810 TTCTTCTTGTCTCCAGCCCCAGG + Intergenic
946955411 2:224924360-224924382 TTTCCCATCTCCCCAGCCCATGG + Intronic
947488636 2:230575124-230575146 TTGCCCTTCTCACCAGGCCTGGG + Intergenic
948150738 2:235742699-235742721 TTTCTCCTATCACCAGCCACAGG - Intronic
948369074 2:237475775-237475797 TTTCCTATGTCCCCAGTCCCTGG + Intergenic
948824090 2:240566077-240566099 GTCCCCTTGTCACCAGGGCCAGG - Intronic
948872194 2:240807537-240807559 TTTCCCTTGTCACTATTACCTGG - Intronic
948886637 2:240888185-240888207 TCTCCCAGGTCAGCAGCCCCAGG - Intronic
1168875289 20:1167514-1167536 ATTCCCTTGCTCCCAGCCCCAGG + Exonic
1168990914 20:2095160-2095182 TTTCCCATGGCACCACCCCCAGG + Intergenic
1169638040 20:7716756-7716778 TTTCCCCTTCCCCCAGCCCCAGG - Intergenic
1169809906 20:9599025-9599047 TTCCCCTTCCCTCCAGCCCCTGG + Intronic
1169975294 20:11318925-11318947 TCTCCCTTCCCCCCAGCCCCAGG - Intergenic
1170047289 20:12098758-12098780 TTTCCATTGTCAGCAGCAGCTGG + Intergenic
1170748830 20:19125617-19125639 TTTCCCTATTCCCCAGCTCCTGG + Intergenic
1170761644 20:19256316-19256338 TTACCCTCTTGACCAGCCCCAGG - Intronic
1171518038 20:25753707-25753729 TTCCCCCTTTCCCCAGCCCCTGG + Intergenic
1171558818 20:26102500-26102522 TTCCCCCTTTCCCCAGCCCCTGG - Intergenic
1172124371 20:32616536-32616558 TCACCCTTGGGACCAGCCCCAGG - Intergenic
1172440421 20:34961651-34961673 TTCTCCTTCTCCCCAGCCCCTGG + Intergenic
1172757665 20:37298395-37298417 TTTCCCTTCCCTCCAGCCCTTGG + Intronic
1172844560 20:37922193-37922215 CTTCCCCTGCCCCCAGCCCCTGG + Intronic
1173244259 20:41324392-41324414 TCTCCCTTCCCCCCAGCCCCTGG - Intergenic
1173312759 20:41915256-41915278 TTTCTCTTCTTCCCAGCCCCTGG + Intergenic
1173404236 20:42751352-42751374 TTTCCTTTGTCCCCAGACCCGGG + Intronic
1173466631 20:43288060-43288082 TTTCCCATGAAACCAGTCCCTGG - Intergenic
1173757223 20:45527387-45527409 TTCCCCCTCCCACCAGCCCCTGG + Intergenic
1173933616 20:46842355-46842377 TTTTCCTCTTCCCCAGCCCCTGG - Intergenic
1175626887 20:60496183-60496205 TTTCCCTTTTCTCCTGGCCCAGG - Intergenic
1175639321 20:60614220-60614242 CGTCCCCTGTCACCAGCCCCAGG + Intergenic
1176197798 20:63845385-63845407 TGCCTCTTGTCACCAGCACCTGG - Intergenic
1176780215 21:13184087-13184109 TTTCCCTTGTCACAAGCCTGGGG - Intergenic
1177512016 21:22099648-22099670 TTCCCCCTGTTCCCAGCCCCTGG - Intergenic
1177947169 21:27485035-27485057 TTTCCCTTACCCCCAGCCCCTGG - Intergenic
1177977873 21:27873105-27873127 TTTCCCTTGTCACAAGCCTGGGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178477248 21:32947725-32947747 TTCCCCTTCCCACCAGCACCTGG + Intergenic
1178823003 21:35992292-35992314 TTCCCCTTCGCCCCAGCCCCCGG + Intronic
1178929040 21:36801067-36801089 TGTCCCATGTCATCAGCCTCAGG - Intronic
1179144643 21:38757122-38757144 TCTCCATTGTCACCAGCCCCTGG + Intergenic
1179429993 21:41315267-41315289 TTACCCTTGCCCCCAGCCCCTGG - Intronic
1179626729 21:42653444-42653466 CTTCCCTTGACTCCAGCCCCCGG - Intergenic
1179650799 21:42807269-42807291 GATCCCCTGTAACCAGCCCCGGG - Intergenic
1179877445 21:44277280-44277302 TTCCCCTTCTCTCCAGCCCCTGG + Intergenic
1181078309 22:20395899-20395921 TTTCCTCTGTACCCAGCCCCTGG + Intronic
1181729739 22:24836107-24836129 TTTCTCCTCTCCCCAGCCCCTGG + Intronic
1183010831 22:34945187-34945209 TTTCCCATCTCACCTGCACCTGG - Intergenic
1183094138 22:35542093-35542115 CTCCCCTTGTCCCCAGCACCAGG + Intronic
1183417692 22:37691903-37691925 TGTCCCTTGTCCTCGGCCCCAGG + Exonic
1183686578 22:39364447-39364469 CTTCCATTGGCACCAGCTCCTGG + Intronic
1183801340 22:40167412-40167434 TTTCCCCTTTCCTCAGCCCCTGG - Intronic
1183988653 22:41583586-41583608 TTACCCCTTTCCCCAGCCCCAGG - Intronic
1184187971 22:42877281-42877303 TGTGGCTTGTCACCCGCCCCTGG - Intronic
1184540167 22:45117196-45117218 TTCCCCCTCTCCCCAGCCCCTGG - Intergenic
1184720337 22:46308926-46308948 TTTACCTTCTCCGCAGCCCCAGG - Exonic
1185210258 22:49566712-49566734 TATCCCTCATGACCAGCCCCTGG - Intronic
950278733 3:11686491-11686513 TTTCCCCATTTACCAGCCCCTGG - Intronic
950346746 3:12302340-12302362 TTTCCTTTCTCTTCAGCCCCTGG - Intronic
950598097 3:14003587-14003609 TTTCCCTTTCCTCCTGCCCCCGG + Intronic
951681787 3:25302587-25302609 TGTCGCTTGTCCCCAGCCCCTGG - Intronic
953924313 3:46974176-46974198 TTCCCCCTTTCCCCAGCCCCTGG - Intronic
954584182 3:51719838-51719860 TTTCCCTGGTGACCAGCCACTGG - Intergenic
954595673 3:51821973-51821995 TTTCCATTATCCCCAGCCCCTGG + Intronic
954990201 3:54833990-54834012 ATTCATTTGTAACCAGCCCCAGG - Intronic
955055718 3:55454327-55454349 TTTCCTCTCTCACCAGCCCCTGG + Intergenic
955138343 3:56243377-56243399 TTTCCCTTGTCAGCAGCTTGAGG - Intronic
955231442 3:57102414-57102436 TTTCTCTTGGCAGCACCCCCTGG + Intronic
955415668 3:58688966-58688988 TTTACCTTCTCAGCAGCCCTGGG - Intergenic
955754177 3:62211333-62211355 TTTCCCCTTTCATCAGCCTCTGG - Intronic
956054425 3:65283437-65283459 TTTCCCCTCTCCCTAGCCCCTGG - Intergenic
956199089 3:66687629-66687651 TTTCCCATATCCCAAGCCCCTGG - Intergenic
956949851 3:74269848-74269870 TTTCCCCTTCCACCAGCCTCTGG - Intronic
957017247 3:75081863-75081885 TTCCCCTTTTCTCCAGCCCCTGG - Intergenic
959165340 3:102770195-102770217 TTTCCAATATCAGCAGCCCCAGG - Intergenic
959521280 3:107325764-107325786 TTTCCCTTCCCACCAAACCCTGG + Intergenic
959877070 3:111395647-111395669 TTTCCCCTGCCCCCAACCCCTGG + Intronic
960592924 3:119382414-119382436 CTCCCCTTGTCACCAGCCCAGGG + Intronic
960864137 3:122183599-122183621 TTATCCTTGTCCCTAGCCCCTGG - Intergenic
960934724 3:122891262-122891284 TTTCCCTTCTTTCCAGTCCCAGG + Intergenic
961831664 3:129626297-129626319 TTTACCTCTTCACCAGCCCAGGG - Intergenic
963007968 3:140743828-140743850 TTCCCCTTCTCCCCAGCCCCTGG - Intergenic
964069300 3:152612270-152612292 CTTCCCTTGTCATCCTCCCCTGG - Intergenic
964181140 3:153887794-153887816 TTTCCCCTTCCCCCAGCCCCTGG - Intergenic
964652472 3:159026911-159026933 TCTCCCCTGTCACCGGCCCAGGG - Intronic
965604627 3:170485940-170485962 ATTCCCTGCACACCAGCCCCTGG + Intronic
966227640 3:177615189-177615211 TCTCCCTTGGCTCCAGCCCAGGG + Intergenic
966280955 3:178228094-178228116 TTCCCCTTCTCCCTAGCCCCTGG + Intergenic
966702444 3:182870082-182870104 TTTCCCCTTCCTCCAGCCCCTGG - Intronic
967756228 3:193172616-193172638 TTTCCCCTCTCTCCAGACCCTGG - Intergenic
968358337 3:198125621-198125643 TTTCCCTTCCCCCCATCCCCTGG + Intergenic
968602692 4:1517843-1517865 TCTCCGGTGGCACCAGCCCCTGG + Intergenic
968629825 4:1644569-1644591 TGTCCCTGGGCGCCAGCCCCGGG + Intronic
970557995 4:17254877-17254899 TTCCCCTTCTTTCCAGCCCCTGG - Intergenic
970850650 4:20598632-20598654 CATCCCTTGTTTCCAGCCCCAGG - Intronic
971374249 4:26043768-26043790 TCTCCCTTCTCTCAAGCCCCTGG + Intergenic
971402788 4:26292221-26292243 TTTCCCTACTCCTCAGCCCCTGG + Intronic
971909506 4:32777319-32777341 TTTCCATTGTTACCAGTCTCAGG - Intergenic
972289975 4:37682837-37682859 TTTTTCATCTCACCAGCCCCAGG + Intronic
972320562 4:37969905-37969927 TTTCTCCTCTCTCCAGCCCCCGG + Intronic
973136421 4:46713383-46713405 TTTCCCTCACCCCCAGCCCCTGG + Intergenic
973279845 4:48347770-48347792 TTTCCATGGACGCCAGCCCCTGG + Intronic
974744152 4:66048183-66048205 TTTCCCTCTTCACCAGTCTCTGG - Intergenic
974826257 4:67134469-67134491 TCACCCTTGACCCCAGCCCCAGG + Intergenic
974967410 4:68778627-68778649 TTTCCCTTTACTCCAGCCCCTGG + Intergenic
974968348 4:68793376-68793398 TTTCCCTTTACTCCAGCCCCTGG - Intergenic
975011771 4:69364037-69364059 TTTCCCTTTACTCCAGCCCCTGG - Intronic
975888399 4:78993548-78993570 TTTCCCTTCTCTCCTGCCCTTGG + Intergenic
978713959 4:111819540-111819562 TTTCCCCTCTCCCCAGCTCCTGG - Intergenic
978757273 4:112316198-112316220 TTTCTCTCTTCCCCAGCCCCTGG + Intronic
979319613 4:119307968-119307990 TTCCCTCTGTCCCCAGCCCCTGG - Intergenic
980124859 4:128764529-128764551 TTTCCCTCCCCACAAGCCCCAGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982696550 4:158608796-158608818 TTCCCCCTCTCCCCAGCCCCTGG + Intronic
985934207 5:3082108-3082130 TTTCCCATGTCTCCAGCACCTGG + Intergenic
986004331 5:3655606-3655628 TTGCCCCCATCACCAGCCCCTGG + Intergenic
986632816 5:9791029-9791051 TTTCACTGGTAACCAGCCCCTGG - Intergenic
986744642 5:10732954-10732976 TTTCCCTTTCCCCCAGTCCCTGG + Intronic
987324699 5:16802165-16802187 TTTCCCCCATCTCCAGCCCCTGG - Intronic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
988160241 5:27510202-27510224 TTTCCTTCATCTCCAGCCCCTGG - Intergenic
988707134 5:33737409-33737431 TTTCCCCTTTCCCCAGCCCCTGG - Intronic
989808783 5:45647091-45647113 TCTCCCCTGTCTCCAGCCTCAGG + Intronic
990031122 5:51261005-51261027 TTTTCCCTTTCACCAGCCCCTGG + Intergenic
990186661 5:53217461-53217483 TTTCCTTTGCTCCCAGCCCCTGG + Intergenic
990425575 5:55685264-55685286 TTTCCCCTTTCCCCAGCCCCTGG + Intronic
990872310 5:60445630-60445652 TTTCCCCCTTCCCCAGCCCCTGG - Intronic
992000507 5:72431753-72431775 TATCTCTTTTCCCCAGCCCCTGG - Intergenic
994083035 5:95729677-95729699 TTTCCCCTCTCCCCAGCCCCTGG + Intronic
994088112 5:95782363-95782385 TTCCCCCTTTCCCCAGCCCCTGG - Intronic
995194325 5:109346740-109346762 TTTCCCATCTTTCCAGCCCCTGG - Intronic
996438559 5:123463207-123463229 TTTCCCCACTCCCCAGCCCCTGG + Intergenic
996758979 5:126967975-126967997 TCTCCCCTTCCACCAGCCCCGGG + Intronic
997592805 5:135086144-135086166 TTCCCCCAGTGACCAGCCCCGGG + Intronic
998513918 5:142735984-142736006 TTCCCCTTGTAAGCACCCCCTGG - Intergenic
998732839 5:145100691-145100713 TTTCCTTTCCCACCATCCCCTGG - Intergenic
999147832 5:149407482-149407504 TTTTCCTTGCCAGGAGCCCCAGG - Intergenic
999181722 5:149674597-149674619 TTTCCCATGTCCCCAGACCTTGG + Intergenic
1000218086 5:159183814-159183836 CTCCCCTTCTCCCCAGCCCCTGG - Intronic
1000480918 5:161772888-161772910 TTTTCCATGTCTCCGGCCCCTGG + Intergenic
1000674887 5:164108622-164108644 TCTCCTCTGTCACCAGCCACAGG - Intergenic
1001125210 5:169013118-169013140 TCTCCCTTGTCCCCTGCACCTGG - Intronic
1002904264 6:1436173-1436195 TTCCCCCTCTCCCCAGCCCCTGG - Intergenic
1002914837 6:1520570-1520592 ATTCCCTTCACTCCAGCCCCTGG + Intergenic
1003292311 6:4789767-4789789 TTACTCTTCTCACCTGCCCCTGG + Intronic
1003866623 6:10369185-10369207 TTTTCCATGCCACCAACCCCAGG + Intergenic
1004351239 6:14892150-14892172 TTCCTCTTGTCTCCGGCCCCTGG - Intergenic
1004735121 6:18398145-18398167 TTCCCCCTCCCACCAGCCCCTGG + Intronic
1004869367 6:19889233-19889255 TTTCCTTTGTCACGCTCCCCTGG - Intergenic
1005635234 6:27746803-27746825 TTCCCCTTCTCCCAAGCCCCTGG - Intergenic
1006054493 6:31373346-31373368 TCTCCCCTGCCACCAGCACCTGG - Intergenic
1006351320 6:33523246-33523268 ATTCCCTTCTCTCCAGCCCCTGG + Intergenic
1006789863 6:36692978-36693000 TTGTCCTTGGCACCAGCCCCAGG - Intergenic
1006845727 6:37060025-37060047 CTGCCCCTGTCACCAGGCCCTGG - Intergenic
1006943145 6:37766065-37766087 TTTCCCTAGGTCCCAGCCCCTGG + Intergenic
1007536610 6:42596814-42596836 TTTTCCTCTTCCCCAGCCCCTGG - Intronic
1007797223 6:44359399-44359421 TCTCCCCTCTCCCCAGCCCCTGG + Intronic
1008205137 6:48646438-48646460 TTTCCCTCCCCACCAGCCTCTGG + Intergenic
1008608164 6:53160704-53160726 GCCCCCTTGTCCCCAGCCCCTGG + Intergenic
1008615198 6:53219582-53219604 TCTCCCTTGTCAACAGCTGCAGG - Intergenic
1009931957 6:70187272-70187294 TCTCCCTTCTCACCATCCCGTGG + Intronic
1010582867 6:77620936-77620958 TTCCCCTTCCCACTAGCCCCTGG + Intergenic
1011614777 6:89187626-89187648 TTTCCCCTCTCCCCAGCCTCTGG + Intronic
1011637908 6:89391587-89391609 TTTCCCTTCTCTCTAGCCACTGG - Intronic
1012126347 6:95433183-95433205 TTCCCCCTGCCCCCAGCCCCTGG - Intergenic
1012154830 6:95805848-95805870 TTTCCCCTCTCACTAGCTCCTGG + Intergenic
1013298741 6:108782941-108782963 TTTCCCTTGCCCCCACCCACAGG - Intergenic
1013590400 6:111615022-111615044 CTTCCCTCCTCCCCAGCCCCTGG - Intergenic
1014575029 6:123059122-123059144 TTGCCCTTGTCACCGCCACCTGG + Intronic
1015417196 6:132963058-132963080 TTTCCCTTGTAAACAGCACCTGG + Intergenic
1018435922 6:163758788-163758810 CTCCCCTTGTTCCCAGCCCCTGG - Intergenic
1018854476 6:167665854-167665876 CTCACCTGGTCACCAGCCCCTGG + Intergenic
1019145080 6:169971083-169971105 AGTCCCCTGTCACCAGCCCCCGG - Intergenic
1021173692 7:17425304-17425326 TTCCCCTTTCCTCCAGCCCCTGG + Intergenic
1022160389 7:27704613-27704635 TCTCCCTTCTCCCCAGCCCCTGG + Intergenic
1022384621 7:29889680-29889702 GTTCCCTTATCAAAAGCCCCAGG - Intronic
1022968379 7:35495208-35495230 TTCCCCCTGCCCCCAGCCCCTGG + Intergenic
1023173093 7:37408745-37408767 TTTCCCTTCTCCCCAGCCCCTGG - Intronic
1023958108 7:44904032-44904054 TTTCCCCTGCCCCTAGCCCCTGG + Intergenic
1024544099 7:50502587-50502609 TATCCCTTCTCCCCAGCCCGGGG + Intronic
1024977846 7:55130442-55130464 TTTTCCTTGTCAACGACCCCAGG + Intronic
1025021929 7:55486965-55486987 TCTCCCCGGTCTCCAGCCCCTGG - Intronic
1025278857 7:57611053-57611075 TTCCCCCTTTCCCCAGCCCCTGG + Intergenic
1025305875 7:57854447-57854469 TTCCCCCTTTCCCCAGCCCCTGG - Intergenic
1027425309 7:78056076-78056098 TTTCCCTCCTCCCCAGCCCCTGG + Intronic
1029241249 7:99164773-99164795 TTTCTTCTGTCCCCAGCCCCTGG + Intergenic
1031843267 7:126772805-126772827 CTACCCTTGTCATCAGCTCCAGG - Intronic
1031987080 7:128170129-128170151 CTTCCCTTGTCCCCAGCCTGGGG - Intergenic
1032143697 7:129358577-129358599 TCTCCCTTCCCTCCAGCCCCTGG - Intronic
1032341834 7:131080914-131080936 TATTCCTTCTCACCATCCCCTGG + Intergenic
1032519639 7:132534288-132534310 CTCCCCAAGTCACCAGCCCCAGG + Intronic
1033198308 7:139346334-139346356 TTTCCCTTGTCCCCATTACCAGG + Intronic
1033881896 7:145894726-145894748 TTTCCCCTCTCCTCAGCCCCTGG + Intergenic
1034297127 7:149983947-149983969 TTCCCCTTATCCCAAGCCCCTGG - Intergenic
1034527167 7:151672537-151672559 TTTCCCCTCCCCCCAGCCCCCGG + Intronic
1034808899 7:154112891-154112913 TTCCCCTTCTCCCAAGCCCCTGG + Intronic
1034822296 7:154227388-154227410 TTTCCCTTCTCCCAACCCCCTGG - Intronic
1035036571 7:155899334-155899356 TTTCCCTGGTGTCCAGCCTCTGG + Intergenic
1035098501 7:156377107-156377129 TGTCCCTCGTCACCACCCCCCGG - Intergenic
1035915871 8:3621423-3621445 TTTCCCTTTGCCCCAGCCCCTGG - Intronic
1035972179 8:4261397-4261419 TTTCCCCTCTCCCCAGCCCCTGG - Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036620238 8:10420264-10420286 TTCCCCTACTCCCCAGCCCCGGG - Intronic
1036705931 8:11046981-11047003 TTTCCCTTCTCCCCAGCCCCTGG - Intronic
1037418336 8:18675219-18675241 GTTCCCTTGTCATGAGCCACTGG + Intronic
1038283330 8:26184938-26184960 TTTTCCCTGTCTCCAGCCCCTGG - Intergenic
1038771314 8:30483767-30483789 TCTCCCTTTTCCCCAGCCCCTGG + Intronic
1038878071 8:31574144-31574166 TTCCCCTTCCCTCCAGCCCCTGG - Intergenic
1040279217 8:46029584-46029606 TTTCCCTTGGCAGCTGCCACTGG + Intergenic
1041053874 8:53962616-53962638 CTTCCCCTCTCGCCAGCCCCTGG - Intergenic
1041079712 8:54204594-54204616 TTTCCCCTATCCCCAGTCCCTGG + Intergenic
1041365244 8:57095842-57095864 TTTCCCTTTTCTTCAGCCACTGG + Intergenic
1041728158 8:61037738-61037760 TTGCCCTGGACACCAGCACCTGG - Intergenic
1042037384 8:64550009-64550031 TTCCCCTTTCCCCCAGCCCCTGG - Intergenic
1042321526 8:67480350-67480372 TTTCCCCTCTCCTCAGCCCCTGG + Intronic
1043964157 8:86453194-86453216 TCCCCCTTTTCCCCAGCCCCTGG + Intronic
1043980795 8:86636745-86636767 TATCCCTTTCCTCCAGCCCCTGG + Intronic
1044146418 8:88720530-88720552 TATCCCTTTCCTCCAGCCCCTGG + Intergenic
1044370353 8:91402968-91402990 CTTCCCTTGCCCCCAACCCCTGG + Intergenic
1044437652 8:92184630-92184652 TTTCCCTCTCCTCCAGCCCCTGG + Intergenic
1044626482 8:94239361-94239383 TTTGCCCTCTCCCCAGCCCCTGG - Intergenic
1045037718 8:98189028-98189050 TTCCCTTTCTCACCAGCCTCAGG - Intergenic
1045223643 8:100222927-100222949 TTTCCTTTCCCCCCAGCCCCTGG + Intronic
1045844149 8:106613863-106613885 TTTCCCTTGCAGCCATCCCCTGG + Intronic
1045873966 8:106957537-106957559 TGTCCCTTCTGACCAGCCCCTGG + Intergenic
1045944875 8:107784178-107784200 TTCCCCTTTCCCCCAGCCCCTGG - Intergenic
1045976495 8:108135282-108135304 TTTCCCCTACCCCCAGCCCCTGG - Intergenic
1047621139 8:126609129-126609151 TTTCCCTTTACTCCAGTCCCTGG + Intergenic
1048233907 8:132672339-132672361 TTCCTCTTGCCACCATCCCCAGG + Intronic
1048396780 8:134021536-134021558 TTTCCCCTCCCTCCAGCCCCTGG + Intergenic
1049832760 8:144712897-144712919 CTTCCCTCTTCAACAGCCCCAGG + Intergenic
1049916586 9:323666-323688 TCTCCCTACTCCCCAGCCCCTGG + Intronic
1050113715 9:2242063-2242085 TTTTCCTTCTCACCCGCCCAAGG + Intergenic
1050488333 9:6159944-6159966 TTTCTCTTGCCCCCAGCTCCTGG - Intergenic
1050492339 9:6201300-6201322 TTTCCCTTACCTCTAGCCCCTGG - Intergenic
1051074506 9:13215124-13215146 TTTCCCCTCTCCCCAGTCCCTGG + Intronic
1052771837 9:32697234-32697256 TTTTCCTTTCTACCAGCCCCAGG - Intergenic
1052883330 9:33619279-33619301 TTTCCCTTGACACCTTTCCCAGG - Intergenic
1053448796 9:38175293-38175315 TTTCCCCTCTCTCCAGCCTCTGG - Intergenic
1053729870 9:41042664-41042686 CTCCCCTTATCCCCAGCCCCTGG - Intergenic
1054698634 9:68389403-68389425 CTCCCCTTATCCCCAGCCCCTGG + Intronic
1055220974 9:73931234-73931256 TTACCCTTGCCTCCAGCCCCTGG - Intergenic
1055458898 9:76497992-76498014 TCCCCCATGTCCCCAGCCCCTGG + Intronic
1056121130 9:83490214-83490236 TTTCCATTGCAACCATCCCCAGG - Intronic
1056684488 9:88748360-88748382 TTTTCCTACTCCCCAGCCCCTGG + Intergenic
1057508790 9:95660492-95660514 TTTGCCTTGTCAAAAGGCCCTGG + Intergenic
1058223828 9:102336418-102336440 TTTCCCTTCTCCACAGCCCCTGG + Intergenic
1058395479 9:104548585-104548607 TTTCCCCTCCCATCAGCCCCTGG - Intergenic
1058488569 9:105468931-105468953 TTCCCCTTCTTACTAGCCCCTGG + Intronic
1058681182 9:107441579-107441601 TTTCCCCTTCCACCAGCCCCTGG - Intergenic
1058977747 9:110140470-110140492 ATTGCATTGTCACTAGCCCCAGG + Intronic
1059350355 9:113659894-113659916 CTTCCCTTGGCACCAGCCTGGGG - Intergenic
1059709717 9:116856393-116856415 TTTCCCTGGTCAGCAGTGCCTGG + Intronic
1060158039 9:121333755-121333777 CTTCCCTATTCGCCAGCCCCTGG + Intergenic
1060219957 9:121759275-121759297 TGTCCCTACTCCCCAGCCCCTGG + Intronic
1061397428 9:130351035-130351057 GTCCCCTTCTCCCCAGCCCCTGG + Intronic
1061518470 9:131103268-131103290 TTTGCTTTGTCCTCAGCCCCCGG - Intronic
1061541126 9:131278213-131278235 TTTCCTTTTTGGCCAGCCCCGGG + Intergenic
1061546320 9:131306759-131306781 ATCCCCTTCTCTCCAGCCCCTGG - Intronic
1062153787 9:135034691-135034713 ATTCCCCTCTCCCCAGCCCCTGG + Intergenic
1062271709 9:135712897-135712919 TTGTCCTTGTCACCCTCCCCAGG + Intronic
1186251738 X:7675014-7675036 TTTTCCCTCCCACCAGCCCCTGG - Intergenic
1186432947 X:9520424-9520446 TCTCCCTGGTCTCTAGCCCCAGG - Intronic
1186459572 X:9737547-9737569 CTTCTCTTCTCCCCAGCCCCTGG - Intronic
1186479290 X:9883861-9883883 ATTCCCTTCTCCCCAGACCCTGG + Intronic
1186983945 X:14990394-14990416 TTTCCCTACTCCTCAGCCCCTGG - Intergenic
1187118793 X:16382816-16382838 TTTCCCTTTTCCCCAGCCCCTGG - Intergenic
1187494818 X:19785911-19785933 TTCCCCTTCCCCCCAGCCCCTGG - Intronic
1188212618 X:27443047-27443069 TTTCCATTGTCATCTGCCTCTGG + Intergenic
1188219392 X:27522606-27522628 TTTCCCCTGTTACCAGACCCTGG + Intergenic
1188813505 X:34682653-34682675 TTTCCCCTCTGCCCAGCCCCTGG + Intergenic
1189055724 X:37697823-37697845 TTTCCCCTGCCCCTAGCCCCTGG + Intronic
1189730921 X:44020096-44020118 TTTCCCCTCCCTCCAGCCCCTGG + Intergenic
1190245284 X:48686803-48686825 TGTCCACTGTCGCCAGCCCCAGG - Exonic
1191727453 X:64296299-64296321 TTTCCCCTCCCAGCAGCCCCTGG - Intronic
1192336883 X:70228840-70228862 TTTCCCTTATCTTCAGTCCCTGG - Intergenic
1192378532 X:70589004-70589026 TTCCCCCTTTCTCCAGCCCCTGG - Intronic
1192453006 X:71254800-71254822 CTTCCCTTGTCTGCAGCCACGGG + Intronic
1192845299 X:74900986-74901008 TTTCCCTTCTCCCCAGCCCCTGG - Intronic
1193120780 X:77820969-77820991 TCCCCCTTCTCCCCAGCCCCTGG + Intergenic
1193278202 X:79616244-79616266 TTTCCCCTTTCACCAGCTCTTGG + Intergenic
1193356844 X:80529451-80529473 TTTCCCCTCTCACTAGCTCCTGG - Intergenic
1193577624 X:83221726-83221748 TTTCCCTTATCCACAGTCCCTGG - Intergenic
1195649435 X:107269394-107269416 TTTCCCCACTCTCCAGCCCCTGG - Intergenic
1196707950 X:118732210-118732232 TTTCCCCTGCCCCTAGCCCCTGG + Intronic
1197700940 X:129599119-129599141 TTTCCCCAATCCCCAGCCCCTGG - Intergenic
1198130208 X:133686587-133686609 TTCCCCTTTCCTCCAGCCCCTGG - Intronic
1198744218 X:139873262-139873284 TTTCTTTTCTCCCCAGCCCCTGG - Intronic
1199204554 X:145133358-145133380 TTTCCCTTTTCCACAGCCCCTGG - Intergenic
1199800784 X:151248614-151248636 TTCCCCTTGTGAAGAGCCCCCGG - Intergenic
1199853522 X:151741624-151741646 TTTCTCTAGCCACCAGGCCCTGG - Intronic
1200410880 Y:2860374-2860396 TTTCCCTTCTTACCAATCCCAGG + Intronic
1200619474 Y:5423772-5423794 CTTCCCTTCCCTCCAGCCCCTGG - Intronic