ID: 1096127726

View in Genome Browser
Species Human (GRCh38)
Location 12:49131643-49131665
Sequence TCCGACTCGCGCCCGCCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096127726_1096127734 22 Left 1096127726 12:49131643-49131665 CCGAGGGGCGGGCGCGAGTCGGA 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1096127734 12:49131688-49131710 CGACGAGGCTTGCCTTAATTCGG 0: 1
1: 0
2: 0
3: 2
4: 22
1096127726_1096127727 -8 Left 1096127726 12:49131643-49131665 CCGAGGGGCGGGCGCGAGTCGGA 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1096127727 12:49131658-49131680 GAGTCGGAAAGACACCGACCAGG 0: 1
1: 0
2: 0
3: 1
4: 33
1096127726_1096127729 -2 Left 1096127726 12:49131643-49131665 CCGAGGGGCGGGCGCGAGTCGGA 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1096127729 12:49131664-49131686 GAAAGACACCGACCAGGGAATGG 0: 1
1: 0
2: 0
3: 12
4: 164
1096127726_1096127730 -1 Left 1096127726 12:49131643-49131665 CCGAGGGGCGGGCGCGAGTCGGA 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1096127730 12:49131665-49131687 AAAGACACCGACCAGGGAATGGG 0: 1
1: 0
2: 0
3: 24
4: 318
1096127726_1096127732 7 Left 1096127726 12:49131643-49131665 CCGAGGGGCGGGCGCGAGTCGGA 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1096127732 12:49131673-49131695 CGACCAGGGAATGGGCGACGAGG 0: 1
1: 0
2: 0
3: 2
4: 69
1096127726_1096127735 25 Left 1096127726 12:49131643-49131665 CCGAGGGGCGGGCGCGAGTCGGA 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1096127735 12:49131691-49131713 CGAGGCTTGCCTTAATTCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1096127726_1096127728 -7 Left 1096127726 12:49131643-49131665 CCGAGGGGCGGGCGCGAGTCGGA 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1096127728 12:49131659-49131681 AGTCGGAAAGACACCGACCAGGG 0: 1
1: 0
2: 0
3: 0
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096127726 Original CRISPR TCCGACTCGCGCCCGCCCCT CGG (reversed) Intergenic