ID: 1096128000

View in Genome Browser
Species Human (GRCh38)
Location 12:49134152-49134174
Sequence TATAAGAATTTGCAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096127994_1096128000 18 Left 1096127994 12:49134111-49134133 CCTGCTGACAGTGGACGTTGATC 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1096128000 12:49134152-49134174 TATAAGAATTTGCAGTTGGTGGG 0: 1
1: 0
2: 2
3: 17
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096128000 Original CRISPR TATAAGAATTTGCAGTTGGT GGG Intergenic
901297678 1:8173152-8173174 AATTAGGATTTGCAGTTGGTTGG - Intergenic
901558204 1:10048353-10048375 TATAGGAGTTTGCAGTTCTTGGG + Intronic
902854639 1:19192353-19192375 TATCAGAATTTCCAATTGCTGGG - Exonic
905181270 1:36168507-36168529 TAAAGGAGTTTGCAGTTGGCTGG + Intronic
905735026 1:40318923-40318945 AAGAAGAATTTGAAGTTTGTTGG + Intergenic
907454320 1:54565395-54565417 TATCAGAAGTTCCAGTTGTTGGG + Intronic
908618543 1:65950168-65950190 TATAAGAATGTGGAATTGGTTGG - Intronic
909390546 1:75115447-75115469 TATAATATTTTCCAGTTTGTGGG - Intergenic
911742113 1:101397842-101397864 TATTTGAATTTTTAGTTGGTTGG + Intergenic
911965907 1:104371355-104371377 TAAAAGGATTTGCAGTAAGTTGG - Intergenic
912257519 1:108076022-108076044 TAAAAGAATTTGCAGATGGTGGG - Intergenic
913038492 1:114999360-114999382 TATAGGAATTTTCACTTGTTGGG + Intergenic
915684974 1:157623878-157623900 TCTAAGAATGTGCTGTTGGAAGG + Intergenic
915690885 1:157689732-157689754 TATAATAATTTGAAGTTGTCTGG - Intronic
917328171 1:173854890-173854912 CCTAAGAATTTGAAGTTTGTTGG + Intronic
919343331 1:196342839-196342861 TACAAGAATATTCAGTTAGTTGG - Intronic
920684106 1:208096016-208096038 AATAAGCACTTACAGTTGGTGGG + Exonic
921151941 1:212409718-212409740 TATATAAATTTGCGGTTTGTAGG + Intronic
921940730 1:220836404-220836426 TATAAGAAATGGCTGCTGGTGGG + Intergenic
922090042 1:222387242-222387264 TGAAAGCATATGCAGTTGGTTGG - Intergenic
922652833 1:227355902-227355924 TATATGAATGTGGAGTTGGCTGG - Intergenic
923354644 1:233142370-233142392 TAAATGAATTTGTAGTTGGAGGG - Intronic
923958995 1:239055902-239055924 TATAAGAATCTGAAGTTCATTGG + Intergenic
1063627505 10:7704213-7704235 TATAAGCCTTTGCATTTGCTGGG - Intronic
1065150039 10:22813256-22813278 TATAAGAATTTGCCATCTGTAGG + Intergenic
1067853865 10:49774163-49774185 TATAAGAATTTGTATTTTGGAGG + Intergenic
1071283081 10:84120462-84120484 TAGAGGAAGATGCAGTTGGTGGG + Intergenic
1074818329 10:117161364-117161386 TATAAGAATTTGGATTAGGCAGG + Intergenic
1076036894 10:127206438-127206460 TATAAGAATATACAGTAGGCCGG - Intronic
1076394273 10:130127210-130127232 TATAAGAATCAGAAGTTTGTTGG + Intergenic
1077090069 11:774317-774339 TATAAAAATTTTTGGTTGGTGGG - Intronic
1079902752 11:26208213-26208235 TATAAGAATTGGGAGTGGGCCGG + Intergenic
1080526719 11:33129430-33129452 TATAAAAATATACAGATGGTGGG + Intronic
1080831670 11:35899303-35899325 TATGAGAATATGCATTTGGCTGG + Intergenic
1081393706 11:42560182-42560204 TAAAAAAATTTGCACTTAGTAGG - Intergenic
1081497068 11:43622658-43622680 TTTAAGAATTTGCAATTTTTTGG + Intronic
1086289233 11:85287558-85287580 TATAGCAATTTGCACTTGCTAGG - Intronic
1086538279 11:87876578-87876600 TCTAGGACTTTGGAGTTGGTGGG + Intergenic
1087315793 11:96600694-96600716 CAGAAGAATGTGTAGTTGGTAGG - Intergenic
1091966076 12:4742960-4742982 CATAAAAATTTGGAGTTGGAAGG + Intronic
1092308118 12:7322623-7322645 TATAAAAATTTACAGTGGGATGG - Intronic
1093241449 12:16681412-16681434 CATAAGAACTTGCACTTAGTTGG + Intergenic
1093716866 12:22392553-22392575 TATCAGTCTTTGAAGTTGGTTGG + Intronic
1093999998 12:25684644-25684666 TTGAAGAATTGGTAGTTGGTTGG + Intergenic
1094765459 12:33589310-33589332 TATAAGAAATGACAGTGGGTTGG + Intergenic
1096128000 12:49134152-49134174 TATAAGAATTTGCAGTTGGTGGG + Intergenic
1096277662 12:50224125-50224147 TATTGGAGTTTGCAGTTTGTTGG - Intronic
1099897310 12:88664908-88664930 TTAAAGAATTTGCAATTTGTGGG - Intergenic
1100345100 12:93722109-93722131 TACAAGAATTCTAAGTTGGTGGG + Intronic
1102620080 12:114187385-114187407 TTTAAAAATTTCCAGTTGTTAGG + Intergenic
1104233268 12:126906244-126906266 TATGAGCATTGGCTGTTGGTCGG + Intergenic
1105414152 13:20194026-20194048 TCTCAGTATTTGCATTTGGTTGG + Intergenic
1105965108 13:25376562-25376584 AATAAGAATTTGCACTTCATGGG + Intronic
1106295142 13:28406296-28406318 AATCAGAATATGCAGTTGGATGG + Intronic
1107136558 13:36950879-36950901 TATAAGAATCTGCTGTGGCTGGG - Intronic
1107570828 13:41656517-41656539 TATGAGACTTTCCAGTTGCTGGG - Intronic
1108748082 13:53416078-53416100 TATCTGAATTTGTAGCTGGTTGG - Intergenic
1109195536 13:59374274-59374296 TTTAAAAAATTGCAATTGGTAGG + Intergenic
1109525799 13:63573791-63573813 AATAAGAATTTGAACTTGGAGGG - Intergenic
1109743488 13:66587601-66587623 TATCAGAATTGGCAGATGGATGG + Intronic
1109909452 13:68890661-68890683 TAGAGGAAGTTGCAGCTGGTGGG + Intergenic
1110104323 13:71652091-71652113 TATAAGCATTTGCATTTATTAGG - Intronic
1112742501 13:102490994-102491016 TATAAGAATTAGAAGGTGGTAGG - Intergenic
1113389131 13:109879004-109879026 TATGGGAATTTGCAGCTGGTGGG + Intergenic
1114273741 14:21122563-21122585 ACTCAAAATTTGCAGTTGGTTGG - Intergenic
1115829329 14:37317071-37317093 TATAAGAATTGGCTTTTGTTAGG + Intronic
1116575700 14:46572436-46572458 TAGAAGAATTTTCAGGTGGAAGG + Intergenic
1117500493 14:56346429-56346451 TAAAAGTATTTACAGTTGGCCGG + Intergenic
1118565512 14:67136527-67136549 TCTAAGAATTTGTGGTTGGTTGG - Intronic
1118764901 14:68903386-68903408 TATAAAAATTAGCCGGTGGTGGG + Intronic
1119220087 14:72899621-72899643 TATATGAATTAGCTGTTGCTAGG - Intergenic
1119976986 14:79036210-79036232 TATAAGAAGTTGGAGGTGGGGGG - Intronic
1122039362 14:98972850-98972872 GAACAGATTTTGCAGTTGGTGGG - Intergenic
1124917088 15:33986403-33986425 TATAAAAATTTACAGTGGGCCGG - Intronic
1125678374 15:41514538-41514560 CATATGATTTTGCAGGTGGTGGG - Intergenic
1125755492 15:42061497-42061519 TACAAAAATTAGCAGATGGTGGG + Intergenic
1127133581 15:55895668-55895690 TGTGAGAATTTGCAGTTCTTGGG + Intronic
1127697185 15:61461902-61461924 TCTAAGAATTTGAAGCTGGGAGG - Intergenic
1128175930 15:65555708-65555730 TATAAGAATTTGAGTTTAGTTGG + Intronic
1128856567 15:71022838-71022860 GACAAGAATGTGCAGTTGCTGGG - Intronic
1130669825 15:85901862-85901884 CATAAGATTTTACAGTTGGCCGG + Intergenic
1130972469 15:88743979-88744001 TATAAGAATTATAAGTTTGTAGG + Intergenic
1131636426 15:94237498-94237520 GATAAGAATTTATAGTTTGTAGG - Intronic
1132850419 16:2022578-2022600 CATAAGAATTGGCTGTTGGCCGG - Intergenic
1134146554 16:11769341-11769363 TTTTAGTAGTTGCAGTTGGTGGG - Intronic
1134848369 16:17460389-17460411 TATAAGAATTTGCATATTCTGGG + Intronic
1135208832 16:20506695-20506717 TATAAGAATATACTGTTGGTAGG + Intergenic
1137946396 16:52736823-52736845 TATATAAATATGCAGTTGATTGG - Intergenic
1139476239 16:67203830-67203852 TAGCAGAAGTTGAAGTTGGTGGG - Exonic
1141725458 16:85785271-85785293 TCTAAAAATTTGTAGTTGGCCGG + Intronic
1141761248 16:86030036-86030058 TATAAGAATGTGCATTTGCTGGG - Intergenic
1144587115 17:16493516-16493538 TATGAGATTTTGCAGTTGCAGGG + Intergenic
1146693235 17:34890955-34890977 GATTAGCATTTGCAGGTGGTGGG - Intergenic
1147777454 17:42912594-42912616 TTTAAGAATGTGCTCTTGGTTGG - Exonic
1149905646 17:60524591-60524613 TTTCAGAATTAGCAGTTGATGGG - Intronic
1150129636 17:62660831-62660853 AATAAAAATTTGCAGATAGTAGG + Intronic
1150967709 17:69990446-69990468 TATACGATTTTGCACTTCGTTGG - Intergenic
1150979732 17:70127567-70127589 TAGAGGAAGGTGCAGTTGGTTGG - Intronic
1153233569 18:2964355-2964377 TATATGAATTTGGTGGTGGTGGG - Intronic
1155787586 18:29919965-29919987 TGTAAGAATGTGAAGTTGCTAGG - Intergenic
1156888986 18:42168095-42168117 TCTAAAAATTAGGAGTTGGTAGG + Intergenic
1157365686 18:47062081-47062103 TATAAGAATTAGAAGTAGGCTGG + Intronic
1157428790 18:47606268-47606290 GATGAGAATTTGTAGTTTGTAGG + Intergenic
1157468701 18:47970736-47970758 CATAAGGAATTGCAGTTGGCGGG - Intergenic
1157550262 18:48576345-48576367 TAGAAGAATTTGCGGTAGCTGGG + Intronic
1157735123 18:50040789-50040811 TAGAAGAACGTGCAGTTAGTTGG - Intronic
1157783510 18:50461280-50461302 GGTGAGAATTTGCAGGTGGTTGG + Intergenic
1158376064 18:56869009-56869031 TATAAGATGATGCAGATGGTAGG + Intronic
1165321697 19:35089365-35089387 AATAAGTATTAGCAGTTGTTGGG - Intergenic
1167206962 19:48109192-48109214 CATATGAATTTGGAGGTGGTGGG - Intronic
925721595 2:6833634-6833656 CATAAGAATTTGGAGGTGGGGGG + Intergenic
928395682 2:30941815-30941837 TTTGAAAATTTGCAGTTGGAAGG - Intronic
928990994 2:37232622-37232644 TATATGAATTTGAAGTGTGTGGG + Intronic
930132639 2:47868435-47868457 TACATGAATTTGCAATTGGAAGG - Intronic
930696207 2:54414207-54414229 TATAGGAAGTCGCAGTTGGTAGG - Intergenic
931000753 2:57779464-57779486 AATAAGAATTTATATTTGGTAGG + Intergenic
931793551 2:65687985-65688007 AATAAGCATATGCAGCTGGTGGG + Intergenic
935837383 2:107069724-107069746 TAAAATATTTTGCAGGTGGTTGG - Intergenic
936591245 2:113806795-113806817 GATAAGACTTTGCAGTATGTTGG - Intergenic
936729418 2:115361916-115361938 TATGAAAATTTGGAGTTGGGGGG - Intronic
937691856 2:124765306-124765328 CCTAAGAATTTGAAGTTGCTTGG + Intronic
939021471 2:136962821-136962843 TATAGGAATTAGAAGTTTGTGGG + Intronic
940639767 2:156333643-156333665 TATTAGAGTTTGCAGAAGGTGGG - Intronic
941991206 2:171559373-171559395 TCTAAAAATTTGGAGTTGGCCGG + Intergenic
944212791 2:197223713-197223735 TATAACTATTTGCAGTTATTTGG - Intronic
944402550 2:199344933-199344955 CATGAGATTTGGCAGTTGGTTGG - Intronic
947260815 2:228220048-228220070 TATACGAATTTGCAGGAGGAGGG - Intergenic
948926812 2:241104220-241104242 TTTAAAAATATGCAGTGGGTTGG + Intergenic
1171401627 20:24876314-24876336 TTTAAAAATGTGCTGTTGGTGGG - Intergenic
1171720876 20:28562250-28562272 CATAAGAATTTGCAATTTCTGGG + Intergenic
1171757190 20:29121304-29121326 CATAAGAATTTGCAATTTCTGGG - Intergenic
1171863246 20:30420564-30420586 CATAAGAATTTGCAATTTCTGGG - Intergenic
1174934690 20:54854637-54854659 TAGAAGAATTAGAAGTGGGTAGG + Intergenic
1175759032 20:61548826-61548848 TAGAAGAATTGGCAGGTGATTGG + Intronic
1176856099 21:13973759-13973781 TAGAAGAATTGGCATTTGATAGG - Intergenic
1177186088 21:17798961-17798983 TAAAAGAGTTTGCAGAGGGTAGG - Intronic
1177823102 21:26053294-26053316 TGTAAGAATTTGCACTTGTCAGG + Exonic
1178010225 21:28276272-28276294 TATATGAATTTGGAGTAGGAGGG + Intergenic
1178118128 21:29438112-29438134 GATAAAAATATGCAGTGGGTAGG - Intronic
1178172013 21:30051740-30051762 AATAAGATTTTGCTTTTGGTTGG - Intergenic
1182918539 22:34058452-34058474 CATCAGAATTTGCATTTGTTGGG - Intergenic
1183678458 22:39312911-39312933 GAACAGATTTTGCAGTTGGTGGG - Exonic
949860982 3:8504504-8504526 TTTATGACTTTCCAGTTGGTGGG - Intronic
951445061 3:22769416-22769438 TATGAAAATTTGCTGTTGTTAGG + Intergenic
952701811 3:36336447-36336469 TATTACAGTTTGCATTTGGTGGG + Intergenic
953080088 3:39608714-39608736 TATAAGCAGTGGGAGTTGGTTGG + Intergenic
954986026 3:54792854-54792876 TCTCAGATTTTGCAGTTGGAAGG - Intronic
957025082 3:75172654-75172676 TCAAAGAATTTGCAGTTGAGAGG - Intergenic
958054498 3:88392048-88392070 CAAAAGAATTTGTAGTTAGTTGG + Intergenic
958261646 3:91388268-91388290 TATTAAAATGTACAGTTGGTAGG - Intergenic
960336004 3:116418440-116418462 AACAAGAATTTGTAGCTGGTTGG - Intronic
961615061 3:128172643-128172665 TATAAGCATATGGAGGTGGTGGG + Intronic
962299088 3:134221763-134221785 TAAAAGAAACTGAAGTTGGTTGG + Intronic
963306051 3:143654473-143654495 TTTTAGACGTTGCAGTTGGTGGG + Intronic
963322948 3:143829245-143829267 TAAAAGAATATGAAGTTTGTAGG - Intronic
964488997 3:157214667-157214689 TATAAGAATTTGGGGTTGTTAGG - Intergenic
964968960 3:162536143-162536165 AATAACAATAGGCAGTTGGTTGG + Intergenic
965756076 3:172028788-172028810 TATAAGTATTTGCAGCTTCTAGG + Intergenic
965833916 3:172830049-172830071 GATAAGAAGTTGCTGTTGGTAGG + Intergenic
967410544 3:189162549-189162571 TATCAGAATTTGGAAGTGGTGGG + Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
971170328 4:24226924-24226946 TATAAGAAGTTCCACTTGGAGGG - Intergenic
972064826 4:34928459-34928481 TATGAGAATATGCATTTGGGAGG + Intergenic
972165483 4:36278648-36278670 AATAAAAATATGCAGTTGATTGG - Intergenic
975180428 4:71338269-71338291 TATAATAGTTTTCAGATGGTAGG + Intronic
975939232 4:79621579-79621601 TTTAAAAATTTGCAGTATGTTGG - Intergenic
976311346 4:83616182-83616204 TATAAGATTTTGGAGTTGTTGGG - Intergenic
976796872 4:88944066-88944088 AATAAGAATTTGCTCTTGCTGGG + Intronic
976897848 4:90133287-90133309 TGCAAGAATTTGCTGTTGATTGG + Intronic
977306527 4:95329878-95329900 TAGAAAATTTGGCAGTTGGTTGG - Intronic
977413603 4:96699979-96700001 TCAAAGAATTTGCAGATGTTTGG - Intergenic
978107306 4:104918872-104918894 TAAAATAATTACCAGTTGGTGGG + Intergenic
978524540 4:109652248-109652270 TATATGAATTTGCAGGGGGTGGG + Intronic
978635120 4:110795260-110795282 TATTAGAATTTACAGATTGTAGG - Intergenic
981878158 4:149574670-149574692 TATAAGCATTAGCAGTTGAAAGG - Intergenic
983078175 4:163351394-163351416 TATTAGTATTTGCTGTTAGTTGG + Exonic
983696119 4:170534013-170534035 GATAATAATTTGCTGTTGGCTGG + Intergenic
984542421 4:181056101-181056123 TATAAAAATGTGAAGTTGGCCGG - Intergenic
984630249 4:182053218-182053240 TATAGGAATTTGCAGTTGGAGGG + Intergenic
987172935 5:15277509-15277531 TATAAGAATGAGCAGATGGCGGG + Intergenic
987174119 5:15289449-15289471 TATATGAATTTGGAGGTGGGGGG + Intergenic
987197252 5:15539042-15539064 TAAAATGATTTGCAGATGGTTGG + Intronic
988341689 5:29980572-29980594 TATAAGACCTTACAGCTGGTCGG - Intergenic
989802555 5:45561932-45561954 TTTAAGACTTTGCATTTGGCTGG + Intronic
990802486 5:59620471-59620493 TTTAAGATTTTGAGGTTGGTTGG + Intronic
990873993 5:60463807-60463829 TGTTTGAATTGGCAGTTGGTTGG - Intronic
993898451 5:93567944-93567966 TATAACACTTTGTAGTTGGATGG - Intergenic
993904970 5:93612479-93612501 TTAAAGAATATGCAGTTTGTGGG - Intergenic
994042686 5:95276049-95276071 TATAAGCAAATGCAGTTGATGGG + Intronic
994337635 5:98586770-98586792 TAGAAGAAATTGCTGATGGTGGG + Intergenic
995005112 5:107182973-107182995 CAAGAGGATTTGCAGTTGGTTGG + Intergenic
996149153 5:120014428-120014450 TATAAGGATTAACAGTTTGTGGG + Intergenic
996506232 5:124270575-124270597 AATAACAATTTTCAGTTGTTAGG - Intergenic
997140067 5:131369481-131369503 TAAAAGAATTTGCTTTTGCTTGG - Intronic
999893703 5:156006068-156006090 TATGAGAATATGCAGTTTGTAGG + Intronic
1000261737 5:159594936-159594958 TAAAAGAATTCGAGGTTGGTGGG + Intergenic
1000263376 5:159611560-159611582 TATAAGAATTTGGAGTTTATAGG - Intergenic
1000864722 5:166499648-166499670 TAAAAGAGTTTGAAGTTTGTGGG + Intergenic
1001059960 5:168479750-168479772 TATAAGAATTTGTAAGTTGTTGG - Intergenic
1004964371 6:20831302-20831324 TTAAAGAAGTGGCAGTTGGTTGG + Intronic
1008372640 6:50751748-50751770 TATATGAATTTGGAGTGGGGTGG + Intronic
1008993515 6:57631877-57631899 TATTAAAATGTACAGTTGGTAGG + Intronic
1009182120 6:60530964-60530986 TACAAAAATGTACAGTTGGTAGG + Intergenic
1009375970 6:62969563-62969585 TATAAGTAGTTGAAATTGGTTGG - Intergenic
1009406091 6:63314426-63314448 TATAACAAATTGCCGTAGGTTGG - Intronic
1009604717 6:65852030-65852052 AATAATAACTTGCAGGTGGTTGG - Intergenic
1009881024 6:69566229-69566251 TATACTAATGTGCATTTGGTTGG - Intergenic
1010108427 6:72195319-72195341 TATAACAAGGGGCAGTTGGTTGG + Intronic
1010745346 6:79554312-79554334 TATAAGAAATTCCAGGGGGTAGG + Intergenic
1010932328 6:81818067-81818089 TGTAAGAATGGGCAGTAGGTGGG - Intergenic
1011799096 6:90990904-90990926 TATCAGACTTTGGAGTTGGGTGG + Intergenic
1011887745 6:92118638-92118660 TATAGGATTCTGCAGCTGGTTGG + Intergenic
1012304748 6:97640497-97640519 TTTAAGAGGTTGCAATTGGTGGG + Intergenic
1013187357 6:107771543-107771565 TATAAGAATTAGCAGTGATTTGG - Intronic
1014245417 6:119062713-119062735 TAAAAGCAGTTGCACTTGGTAGG + Intronic
1014282002 6:119451805-119451827 TATAAGAATTGCCAGCTGGGGGG + Intergenic
1014339482 6:120186600-120186622 TTTAAAAATATGCAGTTAGTAGG - Intergenic
1015017316 6:128429213-128429235 TCTAAGAATTTCGAGTTGGAAGG - Intronic
1015364042 6:132376807-132376829 TATAAGAAGCTGTAGTTGGCCGG - Intronic
1015704692 6:136075336-136075358 TGTGAGAATCTGCAGTGGGTTGG - Intronic
1016533692 6:145087442-145087464 AATAAGAATTAGCACTTGTTTGG - Intergenic
1017238877 6:152145726-152145748 CATAAGAATTCACAGTGGGTGGG + Intronic
1017531979 6:155302683-155302705 TATAGGAATTTTAAGTTTGTTGG + Intronic
1017539751 6:155388455-155388477 TATAATAATTTGAAGGTGTTTGG + Intergenic
1017556989 6:155582435-155582457 TATAAGACTCTGGATTTGGTTGG + Intergenic
1019043224 6:169123209-169123231 TTTAAGAACTTTCCGTTGGTTGG - Intergenic
1020871734 7:13638990-13639012 TAAAAGAATTTTCAGTTCGTTGG - Intergenic
1022739330 7:33106648-33106670 TTTAGGAATATACAGTTGGTGGG + Intronic
1022767588 7:33431421-33431443 TATATGAATTTGGGGTTGGTGGG - Intronic
1023759614 7:43452486-43452508 TTTAACAATATTCAGTTGGTAGG - Intronic
1024619954 7:51148655-51148677 GATATGCATTTCCAGTTGGTAGG - Intronic
1024936091 7:54713676-54713698 TATAAGAATGTGCAGGTGGCTGG + Intergenic
1026779000 7:73251136-73251158 TATAAGAATTTGATCTTGGCTGG - Intergenic
1027019860 7:74804541-74804563 TATAAGAATTTGATCTTGGCTGG - Intronic
1027068166 7:75141400-75141422 TATAAGAATTTGATCTTGGCTGG + Intronic
1027692672 7:81368032-81368054 TATAAGACATTGGAGTTGATAGG - Intergenic
1029428449 7:100512966-100512988 TCTAAGAATTTGAGGTTGGCTGG - Intergenic
1031110605 7:117603999-117604021 TGTAAGAATGTGATGTTGGTGGG + Intronic
1031593827 7:123625218-123625240 TACAAGAATTTGCAACTGATTGG - Intronic
1032880038 7:136079135-136079157 TTTAAAAATTTGCAGTTTATGGG + Intergenic
1033412403 7:141130318-141130340 GATAAGAATTTACGGTTTGTAGG + Intronic
1033847463 7:145451580-145451602 TATAATTAATTGCAGGTGGTAGG - Intergenic
1034080413 7:148272161-148272183 TCTAAAAGTTTGCTGTTGGTTGG - Intronic
1036118770 8:5990951-5990973 TTTAAGAATTTGCATTGGTTGGG + Intergenic
1038980036 8:32749822-32749844 TATGTGAATTTGCAGCAGGTAGG - Intronic
1039235187 8:35495284-35495306 TGTAAGCATTTGTATTTGGTGGG + Intronic
1039684465 8:39783549-39783571 CATAAGAATTTGGAGTGGGAGGG - Intronic
1040761302 8:50848877-50848899 TATAAGAGTCTGCTCTTGGTCGG + Intergenic
1041010771 8:53541177-53541199 TATAGGAATTTGTATTTTGTAGG + Intergenic
1041057799 8:54005642-54005664 TATAAGGATTGGTAGTTGTTTGG - Intronic
1043862365 8:85334679-85334701 TATCAGAACTTGCATTTGATAGG - Intronic
1046056456 8:109084361-109084383 TAAAAGAATGTGCATTTGGCTGG + Intergenic
1050703655 9:8369891-8369913 TCTAAGTATTTGCATTTGTTAGG - Intronic
1050822743 9:9901509-9901531 TCTAAGAATTAACAGTTGCTGGG + Intronic
1051309471 9:15754427-15754449 TATAATACCTGGCAGTTGGTGGG + Intronic
1051846003 9:21451901-21451923 TCTAGGAGTTTGCAGTTGATAGG + Intergenic
1053748058 9:41220817-41220839 CATAAGAATTTGCAATTTCTGGG - Intergenic
1054338324 9:63829689-63829711 CATAAGAATTTGCAATTTCTGGG + Intergenic
1054931176 9:70636971-70636993 CTTAAGAATTTGCCATTGGTTGG - Intronic
1055161149 9:73129600-73129622 TATAAGATTTGGAAATTGGTTGG + Intergenic
1055215820 9:73860856-73860878 TCTGAGAATTCGCATTTGGTGGG + Intergenic
1055607097 9:77982079-77982101 GCTAAGAATTAGCAGTAGGTTGG - Intronic
1058254149 9:102739883-102739905 GGTAAGAATTTGAAGTTGATGGG - Intergenic
1059258914 9:112957083-112957105 TTTAAAAATCTGCTGTTGGTGGG + Intergenic
1202784196 9_KI270718v1_random:31596-31618 CATAAGAATTTGCAATTTCTGGG - Intergenic
1202801309 9_KI270720v1_random:2041-2063 CATAAGAATTTGCAATTTCTGGG + Intergenic
1188482629 X:30651068-30651090 TATAAGAATTCACAGTAGGCCGG + Intergenic
1188603570 X:31999930-31999952 TGTAAGAATTTGCAGCTAATAGG - Intronic
1189149572 X:38691393-38691415 TAAAAAGATTTGCAGTTGGGAGG + Intergenic
1189172345 X:38921785-38921807 TATAAAAATTTGCATCTAGTTGG + Intergenic
1189507778 X:41629743-41629765 TACAAGAATAGGCAGTGGGTTGG + Intronic
1189892662 X:45621611-45621633 TATGAAGATTTGGAGTTGGTGGG + Intergenic
1190918448 X:54827194-54827216 AATAAGAATTGGAAGTTGATTGG + Intergenic
1194289276 X:92049386-92049408 GATAAGAATTTGTGGTTTGTAGG + Intronic
1194577822 X:95636064-95636086 AATAAGAATTTCCTGTTGCTGGG - Intergenic
1194608861 X:96015628-96015650 AATAATAATTTGGAGGTGGTAGG + Intergenic
1197887085 X:131229939-131229961 CATAAGAATTTGTAGTAGATAGG + Intergenic
1200518342 Y:4178333-4178355 AATGAGAATTAGCAGTTGCTTGG - Intergenic
1200763221 Y:7058771-7058793 TAGAGGAAGTTGCAGGTGGTGGG + Intronic