ID: 1096134587

View in Genome Browser
Species Human (GRCh38)
Location 12:49188795-49188817
Sequence CGCCGCCGCAGTGCGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096134587_1096134595 -4 Left 1096134587 12:49188795-49188817 CCTGCACCCGCACTGCGGCGGCG 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1096134595 12:49188814-49188836 GGCGGCGGGGCTTGAGGATTTGG 0: 1
1: 0
2: 0
3: 11
4: 182
1096134587_1096134594 -10 Left 1096134587 12:49188795-49188817 CCTGCACCCGCACTGCGGCGGCG 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1096134594 12:49188808-49188830 TGCGGCGGCGGCGGGGCTTGAGG 0: 1
1: 0
2: 6
3: 117
4: 792
1096134587_1096134596 -3 Left 1096134587 12:49188795-49188817 CCTGCACCCGCACTGCGGCGGCG 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1096134596 12:49188815-49188837 GCGGCGGGGCTTGAGGATTTGGG 0: 1
1: 0
2: 0
3: 3
4: 75
1096134587_1096134597 -2 Left 1096134587 12:49188795-49188817 CCTGCACCCGCACTGCGGCGGCG 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1096134597 12:49188816-49188838 CGGCGGGGCTTGAGGATTTGGGG 0: 1
1: 0
2: 0
3: 2
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096134587 Original CRISPR CGCCGCCGCAGTGCGGGTGC AGG (reversed) Intronic
900349813 1:2228934-2228956 CGCGGCCGCGGTGCCGGCGCCGG + Exonic
901476837 1:9495523-9495545 CTCACCCGCACTGCGGGTGCGGG + Intergenic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
902214121 1:14924039-14924061 CGCCGCGGCGGGGCGGGGGCGGG + Intronic
902896986 1:19485697-19485719 CGCCGACGGGGTGCGGGGGCGGG + Intergenic
903115535 1:21176309-21176331 CGCCGCCGCCGCTCCGGTGCCGG + Exonic
903193542 1:21669344-21669366 CGCCGCCGCAGTTCGGGGAGGGG + Intronic
903597105 1:24503085-24503107 CGCCGCCGCAGGACGGGAGCCGG - Exonic
904467827 1:30718603-30718625 CGCCGGCGCAGGGCAGGGGCGGG - Intronic
907384976 1:54120488-54120510 CACAGCAGCAGGGCGGGTGCAGG + Intergenic
910408414 1:86914634-86914656 CGCAGCCGCAGCGCCGGTGGAGG + Intronic
915325875 1:155080899-155080921 GGCTGCCGCAGTGAGGGAGCCGG - Intronic
918332403 1:183472533-183472555 CCCCGCGGCACCGCGGGTGCTGG - Exonic
922739614 1:228007777-228007799 CCCCGCCGCAGTCCGGGCACGGG + Intronic
923603621 1:235424260-235424282 GGCAGCAGCAGTGCGGGTGGTGG + Intronic
924948048 1:248858935-248858957 CGCAGGCGCAGTGGGGGTGAGGG - Intronic
1062873863 10:930905-930927 TGGCGCCGCACTGCGGGTGCCGG + Intronic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1064086840 10:12351466-12351488 GGCGGCCACAGTGCGGGTCCTGG - Intronic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1069651497 10:70053065-70053087 CGCCGGGGCAGTGCAGGGGCCGG + Intronic
1074586047 10:114768353-114768375 CGCCGCGGCAGAGCGGCTGCTGG - Intergenic
1076643913 10:131938157-131938179 CTCTGCAGCAGTGCGGGTGTGGG + Intronic
1077058428 11:607228-607250 CGCCCCCGCGGTGCGGGCGGGGG - Exonic
1079122460 11:17695746-17695768 GGCCGCGGCCGTGGGGGTGCTGG + Intergenic
1081812635 11:45922384-45922406 CGCGGCCCCAGAGCGGGGGCAGG + Intronic
1084014707 11:66371640-66371662 CTCCGCCCCAGCGCAGGTGCAGG - Exonic
1084331632 11:68433774-68433796 CGCCGTCGCAGCGCAGGCGCAGG - Exonic
1084758306 11:71252544-71252566 CGCCGCCGCGGCTCAGGTGCAGG + Intronic
1089622231 11:119728717-119728739 CGCGGCCGCAGTCCGGGCCCCGG + Exonic
1090385621 11:126356130-126356152 CGCCGCTTCAGTCCGGGCGCAGG - Intronic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1091916177 12:4272967-4272989 GGCCGCCGCAGGCCGGGGGCAGG - Intergenic
1096134587 12:49188795-49188817 CGCCGCCGCAGTGCGGGTGCAGG - Intronic
1100591640 12:96035435-96035457 CGACGCTGCAGCGCAGGTGCAGG + Exonic
1101641374 12:106587492-106587514 CCCCGCCGCTGTGTGAGTGCTGG + Intronic
1111975929 13:94967699-94967721 CGCCGCCGCAGACCCGGAGCAGG + Intergenic
1113254850 13:108495734-108495756 AGCCGCCGCCGAGCGGGTGGCGG + Intergenic
1113954077 13:114087554-114087576 CGGGGCTGCAGAGCGGGTGCAGG - Intronic
1115257616 14:31420035-31420057 GGACGCCGCAGGGCGGGTCCCGG + Intronic
1115474482 14:33800380-33800402 CGCCGCCGCCCTGCGGGGACGGG - Exonic
1121535733 14:94689659-94689681 CGCCGCCTCGTGGCGGGTGCGGG - Intergenic
1122688745 14:103521854-103521876 CGCGGCTGCAGTGCGGGGGGAGG + Exonic
1125541191 15:40471042-40471064 CGGCGCCGCAGCCCGGGAGCCGG + Exonic
1125752065 15:42036176-42036198 GGCCGCAGCAGGGAGGGTGCGGG + Intronic
1127084085 15:55408451-55408473 GGCCGCCGCCGGGCGGCTGCGGG + Intronic
1129240063 15:74245716-74245738 CGCAGCCACAGGGAGGGTGCAGG - Intronic
1132541599 16:512153-512175 CCCTGACGCTGTGCGGGTGCTGG + Intronic
1134213438 16:12297166-12297188 CTCCGCCCCAGTGCAGCTGCTGG - Intronic
1138651471 16:58463726-58463748 CGCCGCCGACGCGCGGGTGCAGG - Intronic
1140927566 16:79599146-79599168 CGGCGGCGTGGTGCGGGTGCAGG + Exonic
1141832963 16:86519957-86519979 CGCCGCCTCTGTCCAGGTGCGGG + Intergenic
1144601418 17:16617936-16617958 AGTAGCCGCGGTGCGGGTGCGGG + Intergenic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1145889732 17:28406061-28406083 GGCAGCCGCAGGGCGGGCGCGGG + Exonic
1146057640 17:29589266-29589288 GGCCGCCGCCGGGCGGGCGCCGG - Intronic
1147617142 17:41836236-41836258 CGCCTGCGCAGTGCGGTCGCGGG - Exonic
1160960609 19:1719051-1719073 CGCCGCCGCAGCGGGGCTGGGGG + Intergenic
1161586898 19:5110611-5110633 CCCTGCCGCAGTGCACGTGCCGG + Exonic
1166543284 19:43619572-43619594 CGCCGCCGCAGAGCCGGAGCGGG - Exonic
1168294967 19:55373838-55373860 CGTCCCCGCAGTGTGGCTGCAGG + Intergenic
927168761 2:20350937-20350959 CGCGGCGGCAGCGCGGGAGCAGG - Intronic
927713811 2:25340897-25340919 CGGCGCCGCAATGTGGGGGCGGG - Intronic
933658074 2:84905575-84905597 CGCCGCAGCAGGGGCGGTGCTGG - Intronic
934085073 2:88503087-88503109 CGCCGCTGCACTGTGGGAGCCGG + Intergenic
934296832 2:91749083-91749105 CGCCGCCGCGGCGCTGGTGGCGG - Intergenic
935165111 2:100563213-100563235 CGCAGGCGCAGTGCGGGAGGCGG + Intronic
940962081 2:159797704-159797726 CGCGGCCGGAGTGGGGTTGCTGG - Intronic
941905399 2:170713976-170713998 CGCGTCCGCAGTGCCGGGGCAGG + Exonic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942241103 2:173964670-173964692 CGCCGCCGGGGGGCGGGTGGGGG - Intronic
943669792 2:190648857-190648879 GGCCGCCGCCGGGCGGGGGCGGG - Intronic
946382406 2:219358223-219358245 CCCCGCCGCTGTGTGGGTCCAGG - Intergenic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1171249433 20:23637340-23637362 CTGCGCCGCAGCGCGGGGGCAGG - Intronic
1171532814 20:25863398-25863420 CGCCACCGCAGCGCGGCGGCAGG + Intronic
1172951100 20:38724072-38724094 CGCCGCCGCAGGGTGGGAGGGGG - Intergenic
1175123544 20:56735278-56735300 CTCTGCAGCAGTGTGGGTGCTGG - Intergenic
1176145609 20:63564057-63564079 CCCCGCCGCCGTGCAGGTGGTGG + Exonic
1183359339 22:37375487-37375509 CGGCGCTGCTGTGCGTGTGCCGG - Exonic
1183702498 22:39457984-39458006 CGCCGCCGCAGTCTGGGGTCGGG - Intronic
1184697867 22:46150112-46150134 CGCGGCCGCGGGGCGGGTGGAGG - Intergenic
1184865021 22:47197451-47197473 CGCCCCCGCCCTGTGGGTGCCGG + Intergenic
950454755 3:13086014-13086036 GGCCGCCGCAGGGCTGGCGCTGG + Intergenic
954025840 3:47782266-47782288 CGCAGTCCCAGTCCGGGTGCAGG - Intergenic
954779067 3:53046013-53046035 CTCCGCCGGAGCGCGGGTGGAGG - Exonic
961735855 3:129001817-129001839 CGCCGCGGCAGTCCAGGTGGTGG - Exonic
972586172 4:40438680-40438702 CGCAGCCACGCTGCGGGTGCGGG + Exonic
979832226 4:125316762-125316784 CCCCACCGAAGTGCGAGTGCTGG + Exonic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
983904434 4:173169205-173169227 TGCCGCGGCAGCGCGGGTGTCGG - Intronic
990512213 5:56499096-56499118 GGCCGCCACAGTGCCGGGGCGGG + Intergenic
990557748 5:56952199-56952221 CTCCGCCGCCGGGCGGGTGCCGG - Intronic
1002106351 5:176881180-176881202 GGCGGCCACAGTGCGGGAGCTGG - Exonic
1002591080 5:180291990-180292012 CGCCGCCGCAGTGGGTGTGAGGG + Exonic
1003306044 6:4930442-4930464 AGCTGCCACAGTGCAGGTGCAGG - Intronic
1007689213 6:43687834-43687856 CGCCGCCGCAGTGGTGGGGCAGG + Intergenic
1016433016 6:144007949-144007971 CGCCGCCTACGTGCGGGTCCGGG - Intronic
1017127387 6:151078850-151078872 CGCCGCCACAGTGTGGCTCCAGG + Intronic
1017793903 6:157823877-157823899 CGCCCCCGCGGGGCGGGTGGGGG + Intronic
1019619810 7:1986409-1986431 TGGCTCCGCAGTGCGGGGGCCGG - Intronic
1021027316 7:15685974-15685996 CGCGGCCCCAGTCGGGGTGCTGG + Exonic
1023881962 7:44325741-44325763 CGCCGGTGCCCTGCGGGTGCGGG - Intronic
1026047973 7:66921243-66921265 CGCCGCCTCAGTTCGGGCTCCGG - Exonic
1029640036 7:101815226-101815248 CACCGCCGCTGTCCGGGTGTGGG + Intergenic
1030201935 7:106914676-106914698 CGACTCACCAGTGCGGGTGCTGG - Intergenic
1031052006 7:116953954-116953976 CGACGCAGCAGGGCGGCTGCCGG - Exonic
1034659857 7:152759762-152759784 AGCCGCCGCAGCGCCGCTGCCGG - Exonic
1034966684 7:155395671-155395693 CGGCCCCGCAGTGTGAGTGCTGG - Exonic
1036560740 8:9898726-9898748 CGGAGCCGCACTGCGGGCGCCGG + Intergenic
1039984616 8:42436915-42436937 GGCCAGCGCTGTGCGGGTGCCGG - Intronic
1045013900 8:97982023-97982045 GGCCGCCCCAATGCGTGTGCAGG + Intronic
1049697188 8:143990102-143990124 AGCGGCCGCCGAGCGGGTGCGGG + Exonic
1053072931 9:35111614-35111636 GGCCGCCGCGGCGCGGGTGGTGG - Intronic
1055090987 9:72364796-72364818 CGCCGCCGCGGGCCGGGAGCGGG + Intronic
1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG + Exonic
1061089727 9:128420187-128420209 GGCCGAAGCAATGCGGGTGCTGG + Intronic
1061261398 9:129482708-129482730 CGCCGCCGCGGCGTGGGGGCGGG + Intergenic
1062110789 9:134781018-134781040 CGGGGCTGGAGTGCGGGTGCTGG + Intronic
1062341409 9:136095304-136095326 CCCCGCCGCGGTGCGGCCGCCGG - Intergenic
1062584143 9:137241507-137241529 CGCCCCCGCATTGCGGCCGCCGG + Intronic
1187507267 X:19887755-19887777 CGCGGCCGCCGGGCGGGGGCGGG + Intergenic
1192546509 X:72018764-72018786 GGGCGCTGCAGTGCGGCTGCGGG + Intergenic
1197776327 X:130120875-130120897 CGCCGCCGCGTTCCGCGTGCAGG - Intergenic
1198530601 X:137547385-137547407 CGCCACCGCGGTCCGGGAGCCGG - Intergenic