ID: 1096143827

View in Genome Browser
Species Human (GRCh38)
Location 12:49264690-49264712
Sequence GCCCCCGCACCCACCGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 271}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096143820_1096143827 3 Left 1096143820 12:49264664-49264686 CCTCGCTGGGGTTTTGCCCACCT 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1096143827 12:49264690-49264712 GCCCCCGCACCCACCGGGGACGG 0: 1
1: 0
2: 3
3: 26
4: 271
1096143813_1096143827 22 Left 1096143813 12:49264645-49264667 CCTCTTACCTGGAGCTTCCCCTC 0: 1
1: 0
2: 3
3: 41
4: 275
Right 1096143827 12:49264690-49264712 GCCCCCGCACCCACCGGGGACGG 0: 1
1: 0
2: 3
3: 26
4: 271
1096143818_1096143827 5 Left 1096143818 12:49264662-49264684 CCCCTCGCTGGGGTTTTGCCCAC 0: 1
1: 0
2: 0
3: 11
4: 82
Right 1096143827 12:49264690-49264712 GCCCCCGCACCCACCGGGGACGG 0: 1
1: 0
2: 3
3: 26
4: 271
1096143819_1096143827 4 Left 1096143819 12:49264663-49264685 CCCTCGCTGGGGTTTTGCCCACC 0: 1
1: 0
2: 2
3: 4
4: 116
Right 1096143827 12:49264690-49264712 GCCCCCGCACCCACCGGGGACGG 0: 1
1: 0
2: 3
3: 26
4: 271
1096143816_1096143827 15 Left 1096143816 12:49264652-49264674 CCTGGAGCTTCCCCTCGCTGGGG 0: 1
1: 1
2: 0
3: 16
4: 228
Right 1096143827 12:49264690-49264712 GCCCCCGCACCCACCGGGGACGG 0: 1
1: 0
2: 3
3: 26
4: 271
1096143812_1096143827 23 Left 1096143812 12:49264644-49264666 CCCTCTTACCTGGAGCTTCCCCT 0: 1
1: 0
2: 4
3: 40
4: 247
Right 1096143827 12:49264690-49264712 GCCCCCGCACCCACCGGGGACGG 0: 1
1: 0
2: 3
3: 26
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096143827 Original CRISPR GCCCCCGCACCCACCGGGGA CGG Intronic
900368968 1:2323114-2323136 GTCCCCGCCCCCTCCTGGGATGG + Intronic
900543589 1:3216410-3216432 GCCCCTGAGCCCACCAGGGAAGG + Intronic
900673398 1:3869617-3869639 GCCTCCGCACCCACCGTGGAGGG - Exonic
900956368 1:5888465-5888487 GCCCCCAGACCCACAAGGGAAGG - Intronic
901018414 1:6244274-6244296 CCCCCCACACCTCCCGGGGAAGG - Intronic
901059583 1:6465871-6465893 GCCCCCAGACCCTCCTGGGAGGG + Intronic
901443515 1:9293250-9293272 GCCCCCGGAGCCACCGCGGGAGG - Intronic
901627937 1:10634297-10634319 GCCTCCGCACCCTCTGGGGCAGG - Intergenic
901709013 1:11099556-11099578 TCTCCTGCACCCTCCGGGGATGG - Intronic
902481997 1:16717007-16717029 GCCCCAGGACCCTCCTGGGAGGG + Intergenic
902520342 1:17012027-17012049 TCCTCCGCACACACCGGGGGCGG + Intergenic
903186899 1:21634052-21634074 GCCCCCCCCCCCCCCCGGGAGGG - Intronic
903248941 1:22038186-22038208 GCCCCCACACCCACTGGAGCTGG - Intergenic
904136031 1:28313285-28313307 GCCACCGCACCCAGCCAGGAGGG + Intergenic
904762883 1:32817973-32817995 GCCCCCACCCCCACTGGGCAGGG - Exonic
904866846 1:33586166-33586188 GCCCACGCCCACACCAGGGAGGG + Intronic
905733308 1:40310988-40311010 TCCCCAGAACCCACAGGGGAAGG + Intronic
906049026 1:42855415-42855437 GCCACCGCACCCAGCCAGGAAGG - Intergenic
912358755 1:109076910-109076932 GCCACCGTGTCCACCGGGGAAGG + Intergenic
912764510 1:112396386-112396408 GGCCCCGCCCCCTCAGGGGATGG - Intronic
914390190 1:147214163-147214185 GCCACCGCACCCGGCCGGGATGG - Intronic
915107741 1:153544948-153544970 GCCCCCGCACCTGGCTGGGAGGG + Intronic
915475192 1:156149086-156149108 GCCACCGCACCCAGCCGGAAGGG + Intronic
917846689 1:179026014-179026036 GCCCCCGCCGCCTCCGGGGAGGG - Exonic
918778299 1:188666322-188666344 GCCCCCGCCCACTCCTGGGAAGG + Intergenic
921051383 1:211514300-211514322 GCGCCTGCACCCTCCGGGCAAGG - Intergenic
921177907 1:212609365-212609387 CCCCCCCCCCCCACCCGGGAAGG - Intronic
922440703 1:225653198-225653220 GCCCCCTCGCCCCCGGGGGAAGG - Intergenic
922503028 1:226110559-226110581 ACCCCCGCCACCACTGGGGAAGG + Intergenic
1062857107 10:784842-784864 GCCCCCGCAGCGCCCGGGGCAGG + Intergenic
1062919305 10:1267160-1267182 GCACCCACACCTACCCGGGAGGG - Intronic
1063669424 10:8087998-8088020 GCCACTGCGCCCAGCGGGGAGGG - Intergenic
1064420589 10:15187201-15187223 GCCACCGCACCCACCCTGCAAGG - Intergenic
1070147566 10:73785855-73785877 GGGCCCGCACCCCCCGGGGCCGG - Exonic
1070152156 10:73811615-73811637 ACCACCGCTCCCACCGGGGGAGG + Exonic
1071603792 10:86971328-86971350 GCCCCGCCACTCCCCGGGGAGGG + Intronic
1073136412 10:101222944-101222966 GCCCCGGGACACAACGGGGAAGG + Intergenic
1075080709 10:119381754-119381776 GCCCCTGCACCTGGCGGGGAGGG - Intronic
1076638909 10:131901014-131901036 GCCGCCGCCGCCGCCGGGGAGGG - Exonic
1077049791 11:561435-561457 GCCTCCGCGCCGCCCGGGGAGGG + Exonic
1077214825 11:1390861-1390883 TCTCCCGCCCCCACCGCGGAGGG - Intronic
1077495783 11:2885951-2885973 GCGCGCACACCCACCGGGGGCGG + Intergenic
1078616451 11:12870556-12870578 TCCCCCGCCCCCCCCGGGGTTGG + Intronic
1080652532 11:34234152-34234174 GCCCCCACCCCAACAGGGGAGGG - Intronic
1083303687 11:61752365-61752387 GCCCCCACCCCGACCCGGGAAGG + Intergenic
1083308662 11:61773580-61773602 GCCCCCTCACTCACCCGAGAGGG - Intronic
1084129851 11:67125145-67125167 GCCACCGCACCCAGCCTGGAGGG + Intronic
1084532090 11:69733313-69733335 GACCCTGCACCCGCAGGGGATGG - Intergenic
1084891403 11:72238759-72238781 GCCCCCACCCCCAGCGGGGGTGG - Exonic
1093894669 12:24562719-24562741 CCCGCCGCACCCCCCGGGGCGGG - Intergenic
1094474867 12:30833296-30833318 GCCCCCACACCCACGCTGGAAGG + Intergenic
1096143827 12:49264690-49264712 GCCCCCGCACCCACCGGGGACGG + Intronic
1097232766 12:57522547-57522569 GCCCCCCCGCCCTCCGCGGAAGG - Intronic
1099127873 12:78788631-78788653 GCCTCAGCATCCACCGAGGAAGG + Intergenic
1100468978 12:94873608-94873630 GCCCCCGCACCCCGGGGCGACGG + Intergenic
1103964852 12:124632242-124632264 GCCCCCGCCCCCACCCAGGTGGG - Intergenic
1104946029 12:132415253-132415275 GCCCCCACACACACCTGGCATGG + Intergenic
1104947228 12:132421474-132421496 GCCCCTGCACCCAGCTGAGATGG + Intergenic
1104974937 12:132548149-132548171 CCCCCTGCACCCACCGGGCGGGG - Intronic
1104987235 12:132603948-132603970 ACCCCAGCTCCCACGGGGGATGG + Intronic
1105851299 13:24338976-24338998 GGCCCCGCACTCACCGCGGCTGG + Intergenic
1106143835 13:27034738-27034760 GCCCACACACCCACTGGGGAGGG + Intergenic
1106322961 13:28659268-28659290 GCCGCCGCCGCCACCGGGGACGG - Intronic
1108365197 13:49704133-49704155 GCCACTGCACCCAGCCGGGAGGG - Intronic
1111147969 13:84209779-84209801 GCCACCGCACCCGGCCGGGACGG - Intergenic
1113200161 13:107858402-107858424 GCCACCGCACCCAGCCGAGATGG - Intronic
1113803201 13:113096922-113096944 GCCCCCGGACGCCCCGAGGAAGG + Exonic
1113891044 13:113735820-113735842 GCCCCTGGCCCCACTGGGGAGGG + Exonic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1117913797 14:60657105-60657127 GCTCCCGCACAGCCCGGGGAGGG - Intronic
1117972405 14:61265192-61265214 GCCACCGCACCCGCCTGGGATGG - Intronic
1121437389 14:93928545-93928567 GCCCCCACCCCCGCCGGGGCTGG - Exonic
1123474713 15:20581697-20581719 CCCTCCGCAGCCACCGGGGATGG + Intergenic
1123474866 15:20582363-20582385 CCCTCCGCAGCCACCGGGGATGG + Intergenic
1123643145 15:22417994-22418016 CCCTCCGCAGCCACCGGGGATGG - Intergenic
1123643298 15:22418660-22418682 CCCTCCGCAGCCACCGGGGATGG - Intergenic
1126458393 15:48889556-48889578 GCCACCGCACCCGGCGGAGAAGG - Intronic
1127880916 15:63157743-63157765 GCGCCCGCGGCCACCGGGGCCGG + Exonic
1128053295 15:64682059-64682081 GCCCCCCCGCCCACCAGGGAGGG + Exonic
1129714088 15:77836955-77836977 GCCCCAGCACCCATAGGCGAGGG + Intergenic
1131236887 15:90704441-90704463 GCCCCCACACCCAGCAGGAAAGG - Intergenic
1132044111 15:98549374-98549396 GCCACCACACCCAGCGAGGAAGG + Intergenic
1132376838 15:101333784-101333806 GCCCGCCCACCCACCCAGGATGG - Intronic
1132468745 16:90074-90096 GCCCGCTCACCCTCCTGGGAAGG + Intronic
1132856901 16:2049536-2049558 GCCACCGCACCCAGCCAGGATGG - Intronic
1136242161 16:28951233-28951255 GCCCCCGGAGCCCCCGGGGCCGG + Exonic
1136366051 16:29809748-29809770 ACCCCCGCACCCACCAGGCAAGG + Exonic
1136579560 16:31143244-31143266 CCCCCCACACCCCCTGGGGAGGG + Intronic
1136627691 16:31472124-31472146 CCCCCCGCCCCCACCGGACACGG + Exonic
1137611565 16:49821729-49821751 GCCTTCGCACACACCGGGGGAGG - Intronic
1138454472 16:57113478-57113500 GCCCCTGCTCCCACCCAGGAGGG - Intronic
1139551314 16:67674657-67674679 GCCCCAGTCCCCACCTGGGAAGG + Exonic
1141436467 16:84002499-84002521 GCCCCTGCCCCCACCTGAGAAGG + Exonic
1141441904 16:84034511-84034533 GCCCCTGCAACCACTGGAGATGG + Intronic
1141670622 16:85489930-85489952 GCGCCCACACCCACCGGGAGTGG + Intergenic
1141703861 16:85654328-85654350 GCCCCCGCTCCCTCAGGAGAAGG + Exonic
1141855888 16:86681411-86681433 GCGCCAGCACCGACCAGGGAAGG - Intergenic
1141950467 16:87336071-87336093 GCCCCAGCACCCACCGGGACAGG + Intronic
1141989474 16:87602230-87602252 GCCCCCGCCCCCTCCGGGAGTGG - Intronic
1142232064 16:88904663-88904685 GCCCCCGCACAACCCGGGGTGGG - Intronic
1142232082 16:88904716-88904738 GCCCCCGCACAATCCGGGGTGGG - Intronic
1142665008 17:1457552-1457574 GCCACCGCACTCGGCGGGGAAGG + Intronic
1142760810 17:2041094-2041116 CCACCTGCACCCACCTGGGAAGG - Exonic
1142979308 17:3662567-3662589 GCCTCAGCTCCCACCTGGGAGGG - Intergenic
1143466488 17:7140247-7140269 GCCGCCGCACCCACCCGGCCAGG + Intergenic
1143803881 17:9409084-9409106 GCCCCCGCCCCCACCAGAGCTGG + Intronic
1144254481 17:13452976-13452998 TCCCCCTCAACCACAGGGGATGG - Intergenic
1146446587 17:32937179-32937201 GCCCCTCCGCCCACCCGGGAGGG + Intronic
1147134784 17:38428533-38428555 GCCCCGGCCCCCACAGGTGAGGG + Exonic
1147207252 17:38846323-38846345 GCCTCCGCACCCAGCCGAGATGG + Intergenic
1148646102 17:49220310-49220332 GTCCCCACCCCCACCGGGTAAGG + Exonic
1148836598 17:50468999-50469021 GCCCCCGCCCTCCACGGGGAAGG + Intronic
1150432538 17:65129840-65129862 GCCACCACACCCACTGAGGATGG - Intergenic
1150498321 17:65626156-65626178 GCCACCGCACCCAGCGGAGATGG - Intronic
1150638402 17:66932767-66932789 GCCACCACACCCAGCGGGAATGG + Intergenic
1151495039 17:74453976-74453998 TCCCCCGCACGCACCTGGGTTGG + Intergenic
1151559492 17:74862783-74862805 GCCCCGGCCCCCAGCAGGGAAGG - Exonic
1151904398 17:77038238-77038260 GCCCCCCCACCCAGCAGGAAAGG - Intergenic
1152049236 17:77959239-77959261 GCCGCCGCCGCCGCCGGGGACGG + Intergenic
1152581162 17:81166143-81166165 GCCGCCGCCCCCACCGGTGCGGG - Intergenic
1152660143 17:81538277-81538299 GCCGCCCCTGCCACCGGGGAAGG + Intergenic
1157488439 18:48106145-48106167 GTCCCCGCACCACACGGGGAGGG + Intronic
1158102192 18:53841964-53841986 GCCACCGCACCCAGCCAGGAAGG - Intergenic
1160873099 19:1285884-1285906 GCCGCCGCACCCGCCGGGGAGGG - Intergenic
1161170547 19:2810493-2810515 GCACCCGCCCCGTCCGGGGAAGG + Intronic
1161911551 19:7198183-7198205 GCCGCCGCAACCGCCGGGGCCGG - Intronic
1162007158 19:7788252-7788274 GACCCCGCACCCCCCGGGCAAGG + Intergenic
1162042590 19:7979659-7979681 TCACCAGCCCCCACCGGGGAAGG + Intronic
1163567426 19:18059833-18059855 GCCCCCCCACCCCCCGGGCAGGG + Intronic
1163830715 19:19545982-19546004 CCCTCCGCACCCGCCGGGGTAGG + Exonic
1163938718 19:20473891-20473913 GCCACCGCACCCAGCCAGGAAGG - Intergenic
1164293078 19:23884940-23884962 GCCACCGCACCCAGCTGAGAAGG + Intergenic
1164448323 19:28336681-28336703 ATCCCCCCGCCCACCGGGGAAGG - Intergenic
1164693729 19:30228340-30228362 GCCCCCGCCCCCGCCGGGGTCGG + Intronic
1165924707 19:39320104-39320126 CCCCCCGCAACCACCGGGAAGGG + Intergenic
1166360417 19:42250810-42250832 GCCCCGGGACCCACCGCCGACGG - Intronic
1166428416 19:42700417-42700439 GCCACCGCACCCAGCCTGGATGG - Intronic
1167093589 19:47361169-47361191 GCCACCGCGCCCAGCCGGGACGG - Intronic
1167300298 19:48673941-48673963 GCCCTCGCACCCCCTGGGGGCGG - Intergenic
1168305537 19:55433276-55433298 GCCCCCGCCCCCGCCGGCGTCGG + Exonic
1202647114 1_KI270706v1_random:152831-152853 CCCTCTGCAGCCACCGGGGATGG + Intergenic
925376231 2:3388122-3388144 GCGCCCCCAGCCTCCGGGGACGG + Exonic
927652310 2:24920087-24920109 GCCCGCGCTCCCGCCGGGGAGGG - Intergenic
927819921 2:26255211-26255233 GCCCCCGCACCCAGCCTGGAAGG - Intronic
927870360 2:26619244-26619266 CCTCCCTCACCCCCCGGGGAGGG - Intronic
931339333 2:61383628-61383650 CCCCCCGCCCCCCCCGGGGGTGG - Intronic
932036500 2:68252056-68252078 GCCCCCGCACCCGACCCGGACGG + Intronic
932337198 2:70938141-70938163 GCCCTCCCACCCCCAGGGGAAGG + Intronic
935549587 2:104438489-104438511 GCCACAGCAGCCACTGGGGATGG + Intergenic
936067428 2:109343101-109343123 GCCTCCACACCCACCCAGGAGGG - Intronic
937145290 2:119639067-119639089 GCCCCCCCACCCCCCCGGGGTGG - Intronic
937183188 2:120013716-120013738 CGCCCCGCCCCCACCCGGGACGG + Intronic
940002171 2:148977198-148977220 GCCCCTGGCCCCACCTGGGAAGG - Intronic
940485583 2:154291580-154291602 GGCCCCGCACCCAGCGTGGCCGG - Intronic
942034695 2:171999693-171999715 GCCCCCGCGCCCAGGTGGGATGG - Exonic
942045157 2:172095649-172095671 GCCCCCACACACACCAGTGAAGG - Intergenic
943669913 2:190649226-190649248 GCCCCCGCTCCCATCGAGGGGGG - Exonic
944616556 2:201465928-201465950 CCTCCCGCATCCCCCGGGGAGGG - Intronic
944880796 2:204011082-204011104 GCCCCTGCAGCCACATGGGATGG - Intergenic
946395605 2:219442324-219442346 ATCCCCGCGACCACCGGGGAAGG + Intronic
946412632 2:219522731-219522753 GCCCCCGCGGCGGCCGGGGAGGG - Intronic
947155984 2:227163947-227163969 GCCCCGGCACCTGCCTGGGAGGG - Intronic
948033269 2:234837052-234837074 GCCACCACGCCCACCTGGGAAGG + Intergenic
948040810 2:234900242-234900264 GCCACCGCACCCAGCGGAAAGGG - Intergenic
948884670 2:240876760-240876782 CCACCCGCACCCGCGGGGGAAGG + Intronic
1171496446 20:25559523-25559545 GCCACCTCACCCAGCTGGGAGGG + Intronic
1172118725 20:32585499-32585521 GCCCCCGCGCCCCCAGGGGCCGG - Intronic
1172763804 20:37340171-37340193 GCCACCGCACCCAGCCAGGAAGG + Intergenic
1172777410 20:37415546-37415568 GACCCAGCACCCACAGGGGGCGG + Intergenic
1173273811 20:41560565-41560587 GCCCAAGCACCCTCCAGGGAGGG + Intronic
1173428259 20:42961655-42961677 GCCCCCACACTCTCCAGGGAGGG + Intronic
1174195426 20:48769434-48769456 GCCCCAGCACCCACTAGGCATGG + Intronic
1175160116 20:57002168-57002190 CACCCCACACCCACCAGGGAGGG + Intergenic
1175926717 20:62474985-62475007 GCCCCCGCACTCACCGAAGGTGG + Exonic
1175947805 20:62566820-62566842 GACCCAGCACCCGCCAGGGAAGG + Intronic
1176547800 21:8208998-8209020 GCGCCCGCCCCCGCCCGGGACGG - Intergenic
1176555692 21:8253200-8253222 GCGCCCGCCCCCGCCCGGGACGG - Intergenic
1176574626 21:8436232-8436254 GCGCCCGCCCCCGCCCGGGACGG - Intergenic
1176604756 21:8819943-8819965 CCCTCTGCAGCCACCGGGGATGG - Intergenic
1176611239 21:8987524-8987546 GCGCCCGCCCCCGCCCGGGACGG - Intergenic
1179492593 21:41751055-41751077 CCCCTGGCACCCACAGGGGATGG + Intronic
1180099215 21:45576610-45576632 CCCCCCGGAACCACCTGGGAAGG + Intergenic
1180190707 21:46161233-46161255 GGCCCCGCTCCCACCGGTGCTGG - Exonic
1180347046 22:11711548-11711570 CCCTCTGCAGCCACCGGGGATGG - Intergenic
1181686918 22:24535655-24535677 GCCACCGCACCCAGCTGGAAAGG - Intergenic
1181817362 22:25448506-25448528 GCCCCCACTCCCACCTGGGCCGG - Intergenic
1182427475 22:30282586-30282608 GCAGCCTCACCCACCTGGGAGGG + Intergenic
1184159428 22:42689082-42689104 GCCGCCACACCCACCCTGGAAGG - Intergenic
1184653118 22:45928252-45928274 GCCCCAGCACCAACCCAGGAAGG + Intronic
1184759489 22:46536748-46536770 GGCCGCGCAGCCGCCGGGGACGG + Exonic
1185322025 22:50205872-50205894 GCCCCCACACCCACAGTGGGAGG - Intronic
1203252674 22_KI270733v1_random:125283-125305 GCGCCCGCCCCCGCCCGGGACGG - Intergenic
1203260730 22_KI270733v1_random:170369-170391 GCGCCCGCCCCCGCCCGGGACGG - Intergenic
949543195 3:5050360-5050382 GCCACCGCACCCAGCCGGGAGGG - Intergenic
950296719 3:11838502-11838524 GCCACCACACCCAGCCGGGAAGG + Intronic
950683921 3:14603030-14603052 GGCCCCGCCCCCGCCGGGCAGGG + Intergenic
952919023 3:38271951-38271973 GCCCCAACACCCACAGTGGATGG - Intronic
953784916 3:45904083-45904105 GCCCAGGCTCCCACCTGGGAAGG - Intronic
953957748 3:47244731-47244753 TCCCATGCACCCACCGAGGAGGG + Intronic
960002617 3:112748850-112748872 GCCACCGCGCCCAGCCGGGAAGG + Intronic
961821206 3:129576550-129576572 GTCCCCTCGCCAACCGGGGACGG + Intronic
962770931 3:138609261-138609283 GCCCCCGCACCGCCCCGGGCTGG - Intronic
962806003 3:138928331-138928353 CCCCCACCACCCACTGGGGAAGG - Intergenic
963806632 3:149729130-149729152 GCCACCGCACCCAGCCTGGAAGG + Intronic
964609664 3:158598415-158598437 GCCCCCCCACCCCCCCGTGAGGG + Intronic
968071934 3:195789472-195789494 GCCCCAGCTCCCACCGGGGATGG - Exonic
968189799 3:196659645-196659667 GTCCCTGCAACCGCCGGGGATGG - Intronic
968353391 3:198080931-198080953 CCCTCCGCAGCCACCAGGGATGG + Intergenic
968549129 4:1213464-1213486 GCCCCCACGCCCACCTGTGATGG + Exonic
968579307 4:1382560-1382582 GCCCCGGCACCCAGCAGAGATGG - Intronic
969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG + Intronic
969514229 4:7637659-7637681 GCCCCCCCACACACCAGGGAGGG - Intronic
970979688 4:22081882-22081904 GCTCCAGCACCCACCGTGCATGG - Intergenic
971257065 4:25024225-25024247 GCCACCGCACCCAGCCAGGAAGG - Intronic
973373368 4:49270994-49271016 CCCTCTGCAGCCACCGGGGATGG + Intergenic
973387642 4:49524214-49524236 CCCTCTGCAGCCACCGGGGATGG - Intergenic
982076503 4:151742372-151742394 GCCACCGCACCCGGCTGGGAGGG + Intronic
983552437 4:169031571-169031593 GCCACCGCACGCACCCTGGAGGG + Intergenic
983552448 4:169031605-169031627 GCCACCGCACGCACCCTGGAGGG + Intergenic
984984517 4:185314940-185314962 GCCACCGCGCCCAGCCGGGAAGG - Intronic
985685518 5:1279726-1279748 GCCACCGCAGCCACAGGGGTGGG + Intronic
985896691 5:2753031-2753053 TCCACCGCACCCACCCGAGACGG - Intronic
986480421 5:8181038-8181060 GCCCCAGCACCCACCTGGTGAGG - Intergenic
992138442 5:73771254-73771276 GCCACCGCACCCAGCCCGGATGG - Intronic
994054383 5:95399482-95399504 CCCCCCCCACCCACCTGTGATGG + Intronic
999315886 5:150583729-150583751 GCCCCCCCAGCCACAGGTGAAGG - Intergenic
1000345848 5:160312632-160312654 GCCCCCGCGCCCCGCGGGGCGGG + Intronic
1002001570 5:176199274-176199296 GCCCCAGCGCCCACTGGGGATGG - Intergenic
1002046385 5:176543697-176543719 ACCTCCGCGCCCACCGGGGCTGG - Intronic
1002082086 5:176743302-176743324 GCACCCGCACCCCCGGGGCAGGG - Intergenic
1002252771 5:177939706-177939728 GCCCCAGCGCCCACTGGGGATGG + Intergenic
1003328417 6:5109958-5109980 GCCCTCGACCCCACCCGGGATGG - Intronic
1004906609 6:20242416-20242438 ACTCCCCCACCCACCAGGGAGGG - Intergenic
1006136998 6:31901569-31901591 GCCCGCGCGCCCACGGTGGAAGG + Intronic
1006597676 6:35205365-35205387 GCCACCGCACCCAGCCCGGAAGG - Intergenic
1006638959 6:35479269-35479291 TCCCCCACTCCCACTGGGGAGGG + Intronic
1010227830 6:73507689-73507711 GCCACCGCACCCTGCCGGGATGG - Intronic
1013995620 6:116304430-116304452 GCCTCAGAACCCACTGGGGATGG - Intronic
1014586333 6:123202231-123202253 CCCCCCGCCCCCACCGTGGTGGG + Intergenic
1014653769 6:124073803-124073825 TCCCCCACCCCCACCGGGCAGGG + Intronic
1015515077 6:134074873-134074895 GCCCCCTCACACACAGGGGTGGG + Intergenic
1018911207 6:168101619-168101641 GCCCGCGCTCCTGCCGGGGAGGG - Intergenic
1020125341 7:5530181-5530203 GCCCCAGCCCCCACCGGGCCTGG + Intronic
1020131873 7:5563244-5563266 GCCCCATCAGCCACCAGGGAAGG - Intronic
1020445346 7:8262064-8262086 GCCCCCGCCCCGACCCCGGAGGG + Intronic
1025033119 7:55572876-55572898 GCCCCCACACCCACGCGTGATGG + Intronic
1025673798 7:63629381-63629403 CCCCCCCCAACCCCCGGGGAAGG - Intergenic
1026947784 7:74327493-74327515 GCCCCCACCCCCACAGAGGATGG + Intronic
1029170451 7:98626317-98626339 GCCCCCGCCTCCACCAGGGGTGG - Intronic
1029424855 7:100488969-100488991 GCTCCCGCTCCCCCCGGGGCTGG - Exonic
1034560457 7:151876555-151876577 GCCGCCGCTCCCGCCGGGGCTGG + Exonic
1035168505 7:157005428-157005450 GCGCCCGCACCCACCCGGCCCGG - Exonic
1035341817 7:158167059-158167081 CCCCCAGCTCCCCCCGGGGAGGG - Exonic
1035816757 8:2549794-2549816 GCCCTCGCACCCACGTGGGCCGG - Intergenic
1037802765 8:22044263-22044285 GCCCCCTCACCCCCCTGGGAGGG + Intronic
1037819909 8:22130578-22130600 GCCCCCGCCGCCCCGGGGGAAGG - Exonic
1037902197 8:22694761-22694783 GCCCACGCGGCCACCGAGGAGGG - Intergenic
1038439336 8:27560541-27560563 GCCCCTGAACCCATGGGGGATGG - Intergenic
1040111911 8:43570427-43570449 GCCCCCGCGCCCAACCTGGAGGG - Intergenic
1040876835 8:52161921-52161943 GCCACCGCACCCACCTGACATGG - Intronic
1041141356 8:54823163-54823185 GGGACAGCACCCACCGGGGAGGG - Intergenic
1042926393 8:73972160-73972182 GCCCCGGAACCCACCGGAGCAGG - Intronic
1047997886 8:130354174-130354196 GCCACCGCGCCCAGCCGGGAGGG + Intronic
1048335104 8:133496807-133496829 GCCACGGCACCCAAGGGGGATGG + Intronic
1048335446 8:133498906-133498928 GCCACGGCACCCACTGGGAATGG + Intronic
1048875950 8:138837297-138837319 GCCGCCACACCTACCGGAGAGGG + Intronic
1049405703 8:142451046-142451068 GCCCCCGCCCCCTCCTGGGGAGG + Intronic
1049570019 8:143365298-143365320 GCCCCAGCACCCACTGGGCAAGG + Intergenic
1049640388 8:143712562-143712584 GCACCCCCACCCACTGGGGCTGG + Intronic
1049950236 9:636579-636601 GCCACCGCACCCAGCCAGGAAGG - Intronic
1051208372 9:14713993-14714015 GCCACCGCACCCAGCCGGTATGG - Intergenic
1051655721 9:19379947-19379969 GTCCCCGCGCCCAGCCGGGACGG - Intronic
1052872657 9:33523714-33523736 CCCTCTGCAGCCACCGGGGATGG - Intergenic
1053489301 9:38487542-38487564 GCTCCTGCGCCCACCGGGCAGGG + Intergenic
1053503396 9:38620854-38620876 CCCTCCGCAGCCACCGGGGATGG + Intergenic
1053752672 9:41273106-41273128 CCGTCCGCAGCCACCGGGGATGG + Intergenic
1054258200 9:62837458-62837480 CCGTCCGCAGCCACCGGGGATGG + Intergenic
1054351599 9:64021339-64021361 CCCTCTGCAGCCACCGGGGATGG - Intergenic
1057684710 9:97221821-97221843 CTCTCCGCAGCCACCGGGGATGG + Intergenic
1057684791 9:97222111-97222133 CCCTCTGCAACCACCGGGGATGG + Intergenic
1057757178 9:97847945-97847967 GCCCCCCCACCCCCCGGGCCTGG - Intergenic
1058215493 9:102227798-102227820 GCCACCACACCCAGCTGGGAGGG + Intergenic
1060573561 9:124666880-124666902 TCCCCCGCCCCCGCCAGGGAAGG - Intronic
1060876474 9:127087535-127087557 GCCCACGTGCCCACCGGGAAGGG + Exonic
1060978398 9:127778790-127778812 GCCCCCGCCCCCTGCGGAGAGGG - Intergenic
1061178395 9:129010554-129010576 TGCCCCACACCCACTGGGGAGGG - Intronic
1061415665 9:130445575-130445597 GCCGCCAGCCCCACCGGGGAGGG - Intronic
1061541625 9:131280568-131280590 GCCCCATCCCCCACCCGGGATGG + Intergenic
1062166102 9:135108057-135108079 GCCCCCGCCCCCATCTGGAAGGG + Intronic
1062464848 9:136676400-136676422 GCCCCCTGACCGACCAGGGAGGG - Intronic
1062582009 9:137232941-137232963 CCCCCCCCACCACCCGGGGAGGG - Intronic
1202800576 9_KI270719v1_random:170918-170940 CCGTCCGCAGCCACCGGGGATGG - Intergenic
1203469077 Un_GL000220v1:108434-108456 GCGCCCGCCCCCGCCCGGGACGG - Intergenic
1203476898 Un_GL000220v1:152406-152428 GCGCCCGCCCCCGCCCGGGACGG - Intergenic
1203552133 Un_KI270743v1:172032-172054 CCCTCTGCAGCCACCGGGGATGG - Intergenic
1189473626 X:41333194-41333216 GCCCCCGCCCCCCGCGGTGAGGG - Intergenic
1190078957 X:47340172-47340194 GCCACCGCACCCAGCGGAGATGG - Intergenic
1196636923 X:118012666-118012688 GCCCCCGCCCCCGCCCAGGATGG - Intronic
1199798649 X:151227846-151227868 GCCCCCGCTCACATCGAGGAGGG + Intergenic
1200277865 X:154751165-154751187 GCCGCCGCGGCCCCCGGGGAGGG + Intronic
1201153414 Y:11107605-11107627 CCCTCTGCAGCCACCGGGGATGG - Intergenic