ID: 1096145314

View in Genome Browser
Species Human (GRCh38)
Location 12:49274860-49274882
Sequence CCGTGGTTCTTGGGGGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096145306_1096145314 -4 Left 1096145306 12:49274841-49274863 CCAAGCACCTGTTGGAGGACCGT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1096145314 12:49274860-49274882 CCGTGGTTCTTGGGGGCAGACGG 0: 1
1: 0
2: 2
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096145314 Original CRISPR CCGTGGTTCTTGGGGGCAGA CGG Intergenic
900365745 1:2311299-2311321 CCCTGGGTGTTGGGGGCAGTGGG + Intergenic
900907799 1:5572998-5573020 CCCTGGATCTTAGGGGCAGGAGG - Intergenic
901921792 1:12541996-12542018 CCGGGATTCTTGGGGCCAAAAGG - Intergenic
902923463 1:19680702-19680724 CCTTGGTTTCTGGGGGCAGGGGG + Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903248902 1:22037892-22037914 CCGTGAATCTTGGGGGAAGGAGG + Intergenic
903273194 1:22204916-22204938 CCCTGGGTCTTCGGGGGAGAAGG - Intergenic
903368305 1:22818352-22818374 CGGTGGTTCATGGGGCCAGGAGG - Intronic
905787060 1:40766840-40766862 CCATGCCTCTTGGGTGCAGAAGG - Intronic
906539759 1:46576298-46576320 CAGTGGTTGTTGGGGGGAAATGG - Intronic
912696274 1:111844500-111844522 CCGTGGATCCTGGGGCCAGCTGG - Intronic
914406341 1:147377494-147377516 CTGTGGCTCTTGGAGGAAGAAGG - Intergenic
916755669 1:167767933-167767955 TCTTATTTCTTGGGGGCAGAAGG - Intronic
918793901 1:188866506-188866528 CTGTGTTTCTTGGGGGCATGAGG + Intergenic
919482856 1:198110697-198110719 CAGTGGTTCTTGGATGTAGAGGG - Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922747191 1:228050981-228051003 CCCTGGTTCCTTGGGGCATATGG + Intronic
1063664696 10:8054418-8054440 CCGCGGGGCTTGGGGGCGGACGG - Intronic
1065494594 10:26315533-26315555 CTGTGATTCTTAGGTGCAGAGGG - Intergenic
1069765008 10:70849677-70849699 CCGTGGTTGTTGAGTGAAGAGGG + Intronic
1071386250 10:85124249-85124271 CAGTGGTTCTTAAGGGCAGGAGG - Intergenic
1073247883 10:102104548-102104570 CAGGGGTTCCTGGGGGCAAATGG + Intergenic
1075258395 10:120943392-120943414 CCATGGTGCTGGGGGGCAGGAGG + Intergenic
1076202424 10:128569178-128569200 CTGGGGGTCTTGGTGGCAGATGG - Intergenic
1076365513 10:129919078-129919100 CCGAGGTGCTTGGGGACAGTGGG + Intronic
1077006572 11:360697-360719 GCGTGGTTCTTAGGGGCCCATGG - Intergenic
1083615361 11:64023498-64023520 GGGCGGTTCCTGGGGGCAGAAGG + Intronic
1084891019 11:72237272-72237294 ACTTTGTTCTTGGTGGCAGATGG - Exonic
1085511630 11:77091113-77091135 CTCTGGTTCTTCCGGGCAGAGGG + Intronic
1089628316 11:119765953-119765975 CAGTGGTTGTGGGGGGCAGTGGG - Intergenic
1090175682 11:124647394-124647416 CCGTGGTTCCCAGGGGCAGACGG - Exonic
1092741464 12:11634069-11634091 CTGTGGTTAGTGTGGGCAGAAGG - Intergenic
1094706768 12:32921996-32922018 TCGTGGGTCATGGGGGTAGAGGG - Intergenic
1096145314 12:49274860-49274882 CCGTGGTTCTTGGGGGCAGACGG + Intergenic
1097270913 12:57773191-57773213 TCGTGGATCTTTGGGGGAGAGGG + Intronic
1106436694 13:29729575-29729597 CTGATGTTTTTGGGGGCAGAGGG + Intergenic
1106926179 13:34615373-34615395 CAGTGGTTGTTAGGGGCTGAAGG - Intergenic
1110603502 13:77403775-77403797 CTGTGGAACTTGGGGGCAAAGGG - Intergenic
1112284831 13:98094905-98094927 CAGTGGTCCTTGGGGGCTGGAGG + Intergenic
1114646977 14:24261270-24261292 CCTTGGGTCATGGGGACAGAGGG + Intronic
1119650191 14:76377666-76377688 TCGTGGTTCTTGGGGGGAGGGGG - Intronic
1120030415 14:79634686-79634708 GCATAGTTGTTGGGGGCAGATGG - Intronic
1121509373 14:94501002-94501024 AAGTGGTTTTTGGGGGTAGAAGG - Intronic
1122234160 14:100322712-100322734 CCCTGGTTCATGTGGGCAGGGGG + Intergenic
1129732612 15:77940653-77940675 CCGTGGGATTTGGGGCCAGAGGG + Intergenic
1132016339 15:98320768-98320790 CCGGCGGTGTTGGGGGCAGAAGG - Intergenic
1133001770 16:2855534-2855556 CCAAGGTGGTTGGGGGCAGATGG - Intronic
1133175740 16:4012915-4012937 CCTTGATTCTTGGTGGCTGAGGG - Intronic
1134226521 16:12395321-12395343 CCTGGGTTGTTTGGGGCAGATGG - Intronic
1138145913 16:54611770-54611792 CTCTGCTTCTTGGGGGCAGTGGG + Intergenic
1138569660 16:57861616-57861638 CCATGGTACTGGGGGCCAGAAGG + Intronic
1141038787 16:80654110-80654132 CCGTGGTGATTTGGGGAAGAAGG + Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1147658691 17:42105513-42105535 TGGAGGTCCTTGGGGGCAGAAGG - Intronic
1147783819 17:42963690-42963712 TAGTGGTGCTGGGGGGCAGAGGG - Intronic
1149132554 17:53322437-53322459 CTATGGATATTGGGGGCAGAAGG + Intergenic
1151942982 17:77304519-77304541 GCCTGGTGCTAGGGGGCAGAAGG + Intronic
1152748177 17:82050831-82050853 CCCTGGCCCTTGGGGGCAGGTGG - Intronic
1152757436 17:82092856-82092878 CCGGGGTGCTGGGGGGCAGGTGG - Intronic
1152863494 17:82709316-82709338 GGGTGGGTCATGGGGGCAGAGGG - Intergenic
1153641988 18:7165329-7165351 CAGTGGTTCTGGGGGGCTGGGGG + Intergenic
1160579896 18:79877730-79877752 CCGTGGTTATTGGGGGAATGTGG + Intronic
1160695608 19:482928-482950 CCCTGGTTCATGGGCGCAGGAGG - Intergenic
1160706679 19:533150-533172 ACCTCGTTCTTGGGGCCAGAGGG + Intronic
1160739936 19:681002-681024 GCGTGGTTCCTGGGTGGAGATGG + Intronic
1165052072 19:33148107-33148129 CCCTGGTTCTTGGGGGCACATGG - Intronic
1165096093 19:33410664-33410686 CCATGCTGCTGGGGGGCAGAGGG + Intronic
1165333442 19:35154109-35154131 CCCTGGGTCTGGGGTGCAGACGG - Exonic
1165454489 19:35902778-35902800 CCTGGGTCCTTGGGGGCGGAAGG + Intronic
1166373704 19:42315676-42315698 CCCTGGTTCCTGGGGGAGGAGGG + Intronic
1166952493 19:46438860-46438882 CCGTGGTGCCTGGCAGCAGAGGG + Intergenic
1166952688 19:46440274-46440296 CCGTGGTGCCTGGCAGCAGAGGG + Intergenic
1167250350 19:48395823-48395845 CCTGGGTCCTTGGGGGAAGAGGG + Intronic
927462642 2:23312463-23312485 GTGTGGTTCTCGGGTGCAGATGG - Intergenic
927847386 2:26478572-26478594 CCATGGCTCATGGGGGGAGAGGG + Intronic
927848160 2:26482367-26482389 CCGGTGTGCTGGGGGGCAGAGGG - Intronic
929537379 2:42792313-42792335 TCTTGGTTCTTGGGGGAAGATGG - Intronic
931665855 2:64609236-64609258 CCGGTGCTCTTGGGGGCAGGGGG + Intergenic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
934854151 2:97718548-97718570 CCGTTGTCCTTGTGGGCAGTGGG + Intronic
936462855 2:112724913-112724935 CCGTGGTCCATGGGTGCAGGTGG - Intronic
938101093 2:128498678-128498700 GCTTGGTTCATGGGGGCAGTGGG + Intergenic
942673426 2:178401653-178401675 TCTTGCTTCTTGGGGGCATATGG + Intergenic
943866976 2:192937880-192937902 CCCTGGGTCATGGGGGCACAGGG + Intergenic
945038161 2:205721939-205721961 CCTTGGATCTTGGAGGGAGAAGG + Intronic
948586594 2:239023855-239023877 GCGTGGGGCTTGGGGGAAGAGGG - Intergenic
1169924110 20:10765429-10765451 CTGGGGTTGGTGGGGGCAGAAGG - Intergenic
1173264051 20:41461707-41461729 AAGTTGTTCTTGGGGGCAGGAGG + Intronic
1173805653 20:45923437-45923459 CAGTGGTTGCTGGGGGCTGATGG + Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1176214199 20:63940576-63940598 CCGAGGTGCCTGGGGGCAGCCGG - Exonic
1176366253 21:6034535-6034557 CAGTGGTTCCTGGGGACAGTAGG - Intergenic
1178692118 21:34758908-34758930 CCGGGCTTCCTGGAGGCAGATGG + Intergenic
1179721154 21:43316591-43316613 CCGTGGAGCTGGGGGGCTGAGGG + Intergenic
1179757264 21:43504010-43504032 CAGTGGTTCCTGGGGACAGTAGG + Intergenic
1180094536 21:45549847-45549869 CTGTGGCTCTTGGTTGCAGATGG + Intergenic
1182115769 22:27755416-27755438 CTCTGGTTCTTGGGGACTGATGG + Intronic
1182506642 22:30787907-30787929 CCGTGGGTCTTAGTGACAGACGG + Intronic
1182895451 22:33855660-33855682 CTGTGGTTCCTGGGGGCAGAGGG - Intronic
1183378521 22:37479095-37479117 CCGTGGTTCCTGGGGGATGGAGG + Intronic
1184341839 22:43890597-43890619 CAGTGGTTCTGGGGGGCAGGCGG - Intronic
1184829794 22:46977416-46977438 CTGAGCTTCTTGGGGACAGAGGG - Intronic
1185202593 22:49517267-49517289 CTGTGCTTCTTGGGGACCGAGGG - Intronic
1185316714 22:50182468-50182490 CAGTAGTCCTTGGGGGCAGCCGG + Intergenic
950120490 3:10479287-10479309 ATGGGGTTCTTGGGGGCTGAAGG - Intronic
951750632 3:26031259-26031281 CCTTGGGTCTTGGGGAAAGATGG + Intergenic
954394948 3:50288497-50288519 TCATTGTTCTGGGGGGCAGAGGG + Exonic
959374330 3:105569783-105569805 CAGTGTTTCCTTGGGGCAGATGG + Intronic
962647494 3:137454901-137454923 CAGTGGTTGTTTGGGGGAGAGGG - Intergenic
966824195 3:183950014-183950036 CCGTGGTTCCTTGTGGCAGTGGG - Exonic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967952917 3:194854596-194854618 CAGGGGTTGTTGGGGGTAGAGGG + Intergenic
968562843 4:1294171-1294193 CCATGGCTCTTCTGGGCAGAAGG - Intronic
969693710 4:8723377-8723399 CCCAGGTTCTTGGGTGCAGCTGG - Intergenic
969921383 4:10543521-10543543 CCGTGGTGCCTGGGCGCAGGGGG + Intronic
975122628 4:70745659-70745681 CCTTGGCATTTGGGGGCAGAGGG + Intronic
977380264 4:96263971-96263993 AAGTGGTTCTTGGGAGAAGAAGG + Intergenic
990938927 5:61180771-61180793 AAGTGATTATTGGGGGCAGAGGG + Intergenic
993708998 5:91204381-91204403 CGGTGGTTGTTGGGGCCAGAGGG + Intergenic
993963963 5:94337102-94337124 CCGTGGTTCTTTAGGGCTGAGGG + Intronic
994040216 5:95250300-95250322 CCATGGGACTTGGGGGCTGAGGG + Intronic
994968445 5:106703877-106703899 CAGTGGTTCTGTGGGGAAGAAGG - Intergenic
997706284 5:135956466-135956488 CCATGTTTCATGGGGGCAAAGGG + Intergenic
1001791491 5:174461215-174461237 CCTGGCTTCTGGGGGGCAGAGGG + Intergenic
1005501026 6:26429384-26429406 CTGTGGTGCTTATGGGCAGAGGG - Intergenic
1005505606 6:26466687-26466709 CTGTGGTGCTTATGGGCAGAGGG - Intronic
1005999996 6:30956995-30957017 CCTGGGTTCTAGAGGGCAGATGG - Intergenic
1006105056 6:31711396-31711418 CCCTATTTCTCGGGGGCAGAGGG + Intronic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006444916 6:34074779-34074801 CCGTGGTGTTTGGAGGCAGATGG + Intronic
1007375727 6:41455351-41455373 CGGTGGTTCTGGGGTGAAGAAGG - Intergenic
1007412656 6:41673917-41673939 CTGTGTTGCTGGGGGGCAGATGG - Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1012449673 6:99342204-99342226 TCATGAATCTTGGGGGCAGAAGG - Intronic
1013166087 6:107593446-107593468 CAGTGATTCTTGGAGCCAGAGGG + Intronic
1013757323 6:113477019-113477041 TCATGGTCCTTGTGGGCAGAAGG - Intergenic
1018638034 6:165882072-165882094 CAGTGGTTCTTTGGGCCAGAGGG - Intronic
1019335818 7:482067-482089 TAGTGCTGCTTGGGGGCAGATGG - Intergenic
1019601260 7:1884857-1884879 CCGTGGGGCAAGGGGGCAGAGGG + Intronic
1019666565 7:2254874-2254896 CCGTGGACCATGGGGGCAGCTGG - Exonic
1022500200 7:30878011-30878033 CCGAGGGACTTGGGGACAGAAGG - Intronic
1023745933 7:43322450-43322472 CCATGGAGCTTTGGGGCAGATGG - Intronic
1026347087 7:69483521-69483543 CTGTGGATCTTTGGGGCTGAGGG - Intergenic
1029223803 7:99010409-99010431 CCCTTGTTCTTGCCGGCAGAAGG + Intronic
1030102751 7:105960852-105960874 CCCTGGTTCTAGGGAGCAAAAGG - Intronic
1035175307 7:157045872-157045894 CCCTGTTTCATGGGGGCACATGG + Intergenic
1035626937 8:1077394-1077416 CCGTGGTTCTCAGGAGCAGAGGG + Intergenic
1036468293 8:9024117-9024139 CAGTCTTTCTTGGGGGCAAAGGG + Intronic
1036698995 8:10998833-10998855 CCATGCTGCTTGGAGGCAGAAGG - Intronic
1043555045 8:81420956-81420978 CTGTGGGACATGGGGGCAGAGGG + Intergenic
1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG + Intronic
1048874781 8:138828111-138828133 CCGTGCTACTTGGGTGCTGAGGG - Intronic
1052418447 9:28208475-28208497 TCAAGGTTCTTGGGGGCAGGAGG + Intronic
1053380893 9:37649450-37649472 CCGTGGATCTGGGTGGCAGAGGG + Intronic
1057629882 9:96711032-96711054 CCGTGGAGCCTGGGGGCAGCTGG - Intergenic
1057943200 9:99302836-99302858 TCCTGGTTCCTGGGGTCAGAGGG - Intergenic
1059446361 9:114340669-114340691 CAGTGCTACTAGGGGGCAGATGG + Intronic
1061479158 9:130888041-130888063 CCGTGCTTCTTGCTGGCTGAGGG + Intergenic
1061622920 9:131823538-131823560 TCGGGGTTCTAGGGGGCAGATGG + Intergenic
1062132705 9:134908568-134908590 CCATGGGGCTTGGGGGGAGAGGG + Intronic
1062331935 9:136048761-136048783 CAGTGCTGGTTGGGGGCAGAGGG - Intronic
1062570532 9:137183045-137183067 TCGTGGTCCTGGGGGGCAGCCGG - Intronic
1185711851 X:2310480-2310502 CAGTAGGTCTTAGGGGCAGATGG - Intronic
1187318536 X:18220420-18220442 CCGTGGCTCTTGGTGGCTCAGGG - Intronic
1187806864 X:23130228-23130250 ACGTGGTGCATGGGGGCACAAGG - Intergenic
1188966457 X:36559347-36559369 ACCTGGTTCTTAGGGGCTGAGGG - Intergenic
1190970278 X:55341851-55341873 CAGTGGGGCTTTGGGGCAGAGGG - Intergenic
1195453026 X:105036987-105037009 CCGTGTTTCTTGGAAGCATATGG - Intronic
1198217620 X:134570255-134570277 CTCTAGTTATTGGGGGCAGAGGG + Intronic
1198302271 X:135344229-135344251 CCGTGGCTGTTGAAGGCAGAGGG + Intergenic