ID: 1096145497

View in Genome Browser
Species Human (GRCh38)
Location 12:49276077-49276099
Sequence GCACCCTGCTTGGGAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096145497_1096145501 -4 Left 1096145497 12:49276077-49276099 CCAGCATTTCCCAAGCAGGGTGC 0: 1
1: 0
2: 2
3: 19
4: 176
Right 1096145501 12:49276096-49276118 GTGCCCTGAGAATAGGATTCAGG 0: 1
1: 0
2: 0
3: 14
4: 131
1096145497_1096145505 9 Left 1096145497 12:49276077-49276099 CCAGCATTTCCCAAGCAGGGTGC 0: 1
1: 0
2: 2
3: 19
4: 176
Right 1096145505 12:49276109-49276131 AGGATTCAGGGTGCCCATATAGG 0: 1
1: 0
2: 0
3: 6
4: 96
1096145497_1096145502 -3 Left 1096145497 12:49276077-49276099 CCAGCATTTCCCAAGCAGGGTGC 0: 1
1: 0
2: 2
3: 19
4: 176
Right 1096145502 12:49276097-49276119 TGCCCTGAGAATAGGATTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 164
1096145497_1096145506 19 Left 1096145497 12:49276077-49276099 CCAGCATTTCCCAAGCAGGGTGC 0: 1
1: 0
2: 2
3: 19
4: 176
Right 1096145506 12:49276119-49276141 GTGCCCATATAGGATCCCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096145497 Original CRISPR GCACCCTGCTTGGGAAATGC TGG (reversed) Intergenic
900629755 1:3628067-3628089 GCACACAGCTGGGGAAGTGCAGG - Intronic
902712946 1:18253132-18253154 GCAGCCTGCTTGGGGAAAGAGGG - Intronic
903789823 1:25885233-25885255 CCACCCTTCCTGGGGAATGCAGG - Intronic
904849106 1:33443769-33443791 GGGCCCTCCCTGGGAAATGCTGG - Intergenic
906196827 1:43934883-43934905 CCACCCTGCTTGGAATCTGCAGG + Intronic
906565781 1:46800071-46800093 GCAGCCAGCTTGGGGAATCCAGG + Intronic
907020841 1:51065648-51065670 GTGCCCAGCTTGGGAAAGGCAGG + Intergenic
908509972 1:64843670-64843692 GCATCAAGCTTGGGAAAAGCTGG - Intronic
912397292 1:109355817-109355839 GCACCCTGATTGAGAACTGCTGG - Intronic
913317553 1:117565708-117565730 GAACCCTGCAGGGGAAATGTGGG - Intergenic
914408344 1:147400257-147400279 CCACCCTGGCTGGGAAAGGCAGG + Intergenic
914874466 1:151502403-151502425 GGACTCTGCTTGGGAAAACCTGG - Intergenic
916295838 1:163218815-163218837 GAACACTTCTTAGGAAATGCTGG - Intronic
917448460 1:175126688-175126710 GGAACCTGCCTGGGAAATGGGGG + Intronic
917634276 1:176919771-176919793 GCAGCCTGCATGGGCAATGGAGG + Intronic
920705463 1:208247646-208247668 GCTCCCAGCCTGGAAAATGCAGG - Intergenic
923675787 1:236079790-236079812 ACACCCTGCATGGGAACTTCAGG + Intergenic
924289770 1:242524863-242524885 GTAGCCTGCTCGGGAAAGGCGGG - Intergenic
1063092212 10:2875232-2875254 CCACCCTGCTTGGGACCTGATGG - Intergenic
1063519776 10:6730764-6730786 ACACACAGCTTGGGAACTGCAGG + Intergenic
1063952825 10:11240198-11240220 GAACACTGCTTTGGAAATTCGGG - Intronic
1067279754 10:44862277-44862299 GCAACCTGCTTGGGCACTGCAGG + Intergenic
1070160879 10:73866066-73866088 GCAGGCTGCTGGGGAAAGGCTGG - Intronic
1070332965 10:75431274-75431296 TAACCCAGCTTGCGAAATGCAGG + Intergenic
1070393196 10:75989047-75989069 GCAACCTGCATGGGAAATGAGGG - Intronic
1071268185 10:83982823-83982845 AGACCCTGCTTGGGAACTGTGGG + Intergenic
1071790068 10:88943959-88943981 GGTCCCTTTTTGGGAAATGCAGG - Intronic
1072761098 10:98057479-98057501 GCTCCGTGCTGGAGAAATGCTGG + Intergenic
1074363177 10:112838809-112838831 GCCCCCAGCTAGGGAGATGCAGG - Intergenic
1076256753 10:129032766-129032788 GCACCCAGCAAGGGAAAGGCTGG - Intergenic
1080728374 11:34919814-34919836 GTACCCTGCTTGGGAAGTAGTGG + Intronic
1081643940 11:44777132-44777154 GTACCCTGCCTGGGGGATGCTGG + Intronic
1081849141 11:46262898-46262920 GCACAGTGCTTGGGAAGTGATGG - Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1086095698 11:83048167-83048189 GCACCCTGCTCTAGATATGCTGG + Intronic
1087990346 11:104741082-104741104 CAAGCCTGCTTTGGAAATGCAGG + Intergenic
1089007765 11:115106633-115106655 TCAGCCTGCTTGGGAAGTGAGGG + Intergenic
1090711694 11:129392062-129392084 CCACTCTGCTGGGGAAGTGCAGG + Intronic
1091476088 12:774255-774277 TCACCCTCCTTGGGAGCTGCAGG - Intronic
1092035691 12:5332746-5332768 GCATGCTGCTGGGGAAATGCTGG + Intergenic
1094470324 12:30796413-30796435 GGACACTGCTTGGGCCATGCGGG - Intergenic
1094825261 12:34264627-34264649 GCACCCTGCTTGGAAAGTTCCGG + Intergenic
1095263536 12:40126231-40126253 GCACCCTGCTAGGGGAAGGAAGG + Intergenic
1096145497 12:49276077-49276099 GCACCCTGCTTGGGAAATGCTGG - Intergenic
1096629465 12:52916577-52916599 GTACCCTGCTGGGCAGATGCTGG - Intronic
1099278269 12:80606530-80606552 GCACCCTGCTTGGGTTTTGCTGG + Intronic
1102490878 12:113288877-113288899 GCCCTCTGCCCGGGAAATGCAGG - Intronic
1103375633 12:120453504-120453526 GAACCCTGATTGGGAAAGACAGG + Intronic
1103567510 12:121823874-121823896 AAACCCTGCTTGGGAAGTGACGG - Intronic
1103743633 12:123107674-123107696 GCACCCTGCTTGGGAGTTTGTGG - Intronic
1105029807 12:132874574-132874596 GCACCCAGCGTGGGAAAGCCAGG + Intronic
1108179099 13:47823293-47823315 AAACCCACCTTGGGAAATGCTGG + Intergenic
1108358650 13:49650331-49650353 CCAACATGCTTGAGAAATGCTGG + Intergenic
1111604414 13:90519542-90519564 GCTCCATCCTAGGGAAATGCAGG - Intergenic
1112184727 13:97116575-97116597 GCAGCCTGGTTGGGAAATTGGGG + Intergenic
1112440952 13:99424527-99424549 GTACCCAGATTGGGGAATGCTGG + Intergenic
1112578954 13:100662163-100662185 GTACCCTGCTGGGGAGCTGCTGG + Intronic
1112578979 13:100662275-100662297 GCACTCTGCTGGGGAGCTGCTGG - Intronic
1113074245 13:106452274-106452296 GCATACTGCTTGGCAAATGATGG - Intergenic
1113549186 13:111178690-111178712 CCACCCAGCTTGGAAAAGGCAGG + Intronic
1118839993 14:69502708-69502730 GCCCCTTCCTTGGGAGATGCTGG + Intronic
1122337256 14:101001919-101001941 GCCCCATCCTTGGGCAATGCTGG + Intergenic
1122574378 14:102732456-102732478 GCACGGTGCTTGGGAGCTGCAGG - Intergenic
1122971876 14:105155561-105155583 GCACCGTGCCTGGGGAGTGCAGG - Exonic
1124164980 15:27318401-27318423 GCACCCTGCCAGGGAGATGGGGG + Intronic
1124379308 15:29151404-29151426 GCACCTTGCTTTGGAGGTGCTGG + Intronic
1126917303 15:53480015-53480037 GGACTCAGTTTGGGAAATGCTGG + Intergenic
1127826605 15:62709269-62709291 GGAGCTTCCTTGGGAAATGCAGG + Intronic
1128194255 15:65736638-65736660 GCACCAAGCTTGACAAATGCTGG - Intronic
1130937518 15:88482805-88482827 GCACAGTGCTGGGGAAATGATGG + Intergenic
1131487221 15:92831315-92831337 ATACACTGCTTTGGAAATGCTGG + Intergenic
1133291527 16:4725371-4725393 GAACCATGCATGGGAAATGCTGG + Intronic
1134657627 16:15959086-15959108 ACAACCTCCTAGGGAAATGCAGG - Intronic
1136101218 16:27997782-27997804 GGACACTGCTTGGGTAATGGGGG - Intronic
1136377144 16:29872382-29872404 GTAGCCTGCTTGGGGACTGCCGG - Intronic
1137771441 16:51018941-51018963 GCAGCACACTTGGGAAATGCTGG + Intergenic
1138388721 16:56654383-56654405 GCACCCTGCTGGGAACATGCTGG - Intronic
1139224565 16:65221901-65221923 AGAGCCTGCTAGGGAAATGCTGG + Intergenic
1140232545 16:73129526-73129548 GCCCTCTGCTTGTCAAATGCTGG + Intronic
1203142114 16_KI270728v1_random:1773554-1773576 GAACCCAGCTTGGGAGATGATGG + Intergenic
1142559443 17:801239-801261 GCCCTCTGCTTGGGAAACGCCGG - Intronic
1144548162 17:16216151-16216173 TCACCCTGCTGGGGAAACGACGG + Intronic
1146482926 17:33219613-33219635 GGACACAGTTTGGGAAATGCAGG - Intronic
1148177884 17:45583777-45583799 TTGCCTTGCTTGGGAAATGCAGG - Intergenic
1149832771 17:59886425-59886447 TCAGCCTGCTTAGCAAATGCTGG - Intronic
1151959815 17:77399784-77399806 GCACCCTGCATGCAAACTGCTGG - Intronic
1153226581 18:2905057-2905079 GAACCCTGGTTGAGAAAGGCTGG - Intronic
1159963525 18:74574582-74574604 ACAGCCTTCTTGGGAAGTGCGGG - Intronic
1165780091 19:38427453-38427475 ACACCCTGCTTAAGAAAGGCAGG - Intergenic
1167745843 19:51351481-51351503 GCCTCCAGCTGGGGAAATGCCGG - Intronic
925294553 2:2768588-2768610 GAACCCTGCTTGGGACAGACGGG - Intergenic
925885683 2:8392286-8392308 GCAGCCTGCCTCGGGAATGCAGG + Intergenic
925913159 2:8586544-8586566 GCCCCCTGCTTGGGAGCTCCTGG - Intergenic
926563857 2:14447747-14447769 GCACACAGCTTGGAAACTGCAGG - Intergenic
931257208 2:60584125-60584147 CCCCACTGCTAGGGAAATGCTGG - Intergenic
931295250 2:60917600-60917622 GCTCACTGCATGGCAAATGCTGG + Intronic
931650878 2:64467682-64467704 ACACACTGCTTGGGAAATGCAGG - Intergenic
932117643 2:69067781-69067803 GCCCCCTGCCTGGGGATTGCTGG + Intronic
932134742 2:69218474-69218496 TCAAACTGCTTGGAAAATGCAGG + Intronic
932231615 2:70088072-70088094 GCTCCCTGATTGGGAAAGGCGGG + Exonic
933183285 2:79251214-79251236 GCAGCCTGCTTCGGAAGCGCAGG - Intronic
934922390 2:98356092-98356114 CCATCCTGCTTGAGAACTGCAGG - Intronic
935821673 2:106899107-106899129 GCACACTGTTTGGGAACTGTGGG - Intergenic
939067776 2:137505139-137505161 GGCCCCTTCTTGGGAAATGTGGG - Intronic
939853458 2:147327893-147327915 ACACCCTGGTTAGGAACTGCAGG - Intergenic
940263239 2:151807472-151807494 GAATCCTGATTGGGAAAGGCTGG - Intronic
940436855 2:153666109-153666131 GCACCCTGGTTGGGTAATGAAGG - Intergenic
940617413 2:156066575-156066597 GCACATTGCTTTGTAAATGCTGG + Intergenic
942225694 2:173813679-173813701 GCACCCTGCTCGGGATTTCCTGG + Intergenic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
1172222020 20:33280573-33280595 GCCCCCTGCATGAGAGATGCAGG + Intronic
1173249713 20:41358064-41358086 GCCCCCTGGTGGGGAAAGGCAGG + Intronic
1173364661 20:42373979-42374001 TCACCCTGTTTGGGAACTGGGGG + Intronic
1173577738 20:44123929-44123951 AGGCCCTGCTGGGGAAATGCAGG + Intronic
1174808069 20:53621891-53621913 GCACCCTGCGGGGGCAATGGAGG - Intergenic
1174830700 20:53809463-53809485 GCAACGTGCATGGGAAATGCAGG - Intergenic
1175291687 20:57880231-57880253 AAAGTCTGCTTGGGAAATGCCGG + Intergenic
1175687543 20:61042592-61042614 GAACACTGCTTGGGACTTGCTGG - Intergenic
1179517022 21:41915392-41915414 GAACCCGGTTTGGGAAATGCTGG - Intronic
1182464470 22:30505805-30505827 GCACCCTACTTGGGACAGGGAGG + Intergenic
1183342210 22:37287660-37287682 CCAAACTGCTTGGGACATGCAGG - Intronic
1183582262 22:38733075-38733097 GGAGCCTGCCTGGGAAAAGCCGG - Exonic
1184287959 22:43482650-43482672 GCACACTGCTTGGCACATGGTGG + Intronic
1185013914 22:48332721-48332743 GCTTCCTCCGTGGGAAATGCTGG - Intergenic
1185348953 22:50324184-50324206 GCAGCCTGCTTGAGAGATGAGGG - Intronic
949749002 3:7329297-7329319 GGACCCTGCTTGTTAAATGATGG - Intronic
950081234 3:10223727-10223749 GAACCCAGTCTGGGAAATGCTGG + Intronic
951619053 3:24580762-24580784 GAACACTGCTTGGGAGATGATGG - Intergenic
953447104 3:42977986-42978008 GAGCCCTGGTTGGGAAATGAGGG - Intronic
954092541 3:48296542-48296564 GAACCCTCCTTGGGAAAAGATGG + Intronic
958462635 3:94418548-94418570 GCACCCTGCTTGGGCAACCAAGG - Intergenic
959537504 3:107502990-107503012 GCACACTGCTTGGGAAAGTATGG + Intergenic
959559340 3:107761622-107761644 GAACCCTGCTTCGGGAAGGCTGG + Intronic
960292763 3:115906284-115906306 GCACCATGCTTAATAAATGCTGG - Intronic
961111435 3:124287190-124287212 ACACAGTGCTGGGGAAATGCTGG - Intronic
961131401 3:124470929-124470951 TCACCTTGTTTGGGAAATGTTGG - Intronic
963493723 3:146033817-146033839 ACATCCTTCTTTGGAAATGCTGG - Intergenic
967294817 3:187954634-187954656 AGAACCTGCTTGGGAAATGGGGG + Intergenic
968943556 4:3651957-3651979 GCACCCTCCCTGGGGAATCCTGG + Intergenic
970837762 4:20431435-20431457 GCAGCCTGCCTGGCAAAAGCAGG + Intronic
970869987 4:20804993-20805015 GAACCCTTCTTGGGAAATTTTGG - Intronic
970955082 4:21801547-21801569 GAACACTGCTTGGAAAATGGTGG + Intronic
973340336 4:48996891-48996913 GAACACAGTTTGGGAAATGCTGG - Intronic
973757111 4:54086222-54086244 GCAACCAGCTTGCAAAATGCTGG + Intronic
976659856 4:87529322-87529344 CCAGCCTGCTAGGGAAATCCAGG - Exonic
983616850 4:169716047-169716069 GGAACATGCTTTGGAAATGCTGG + Intronic
985574286 5:666372-666394 GCACTCTGCTGGGGCAGTGCCGG + Intronic
985926120 5:3020499-3020521 GAAGCCTGCATGGTAAATGCCGG + Intergenic
988681446 5:33488242-33488264 TCTCCCTGCTTGGGAAGTGCAGG + Intergenic
991488542 5:67163186-67163208 GGACCCTGCTGGGGAATTGGGGG - Exonic
997011902 5:129888293-129888315 TAACTCTGCTTGGGAAATTCTGG - Intergenic
1001155846 5:169271952-169271974 GCACAGTGCTGGGGAAAAGCAGG + Intronic
1001651807 5:173321091-173321113 CCAGCCTGCTCTGGAAATGCAGG - Intronic
1001743832 5:174074766-174074788 GGACACTGCATGGGCAATGCTGG - Intronic
1001871902 5:175163515-175163537 GCACCTCGCCTGGGATATGCAGG + Intergenic
1002095848 5:176830248-176830270 CCACCCTGCTTGGGAGCTCCTGG - Intronic
1002993267 6:2257557-2257579 GCACCCTGCCAGGGAAATTTGGG + Intergenic
1003280924 6:4690658-4690680 GCACCCTGCTTGGCAGGTGAAGG - Intergenic
1004754296 6:18595183-18595205 TCTCCCTACTTGGGAAATGGTGG - Intergenic
1005089684 6:22043420-22043442 GCTCCCTGCTTGGGGAAGGGTGG + Intergenic
1007686701 6:43671417-43671439 GCTCACTGCTTGGGAAGTGCAGG - Exonic
1012489508 6:99765329-99765351 GCATCCTGCTTGTAGAATGCTGG - Intergenic
1013352836 6:109320959-109320981 TCGCACTGCTGGGGAAATGCTGG - Intergenic
1014610741 6:123541561-123541583 GCTCCATGCTTGGGAAAGACAGG + Intronic
1017819819 6:158041186-158041208 CCACCCTGCTGGGCAAATGGGGG + Intronic
1024157936 7:46645413-46645435 GCACCCTGGTTGGGAGGAGCAGG + Intergenic
1025204711 7:56985515-56985537 CCACCCTCCTGGGGAAAGGCGGG + Intergenic
1025667226 7:63591420-63591442 CCACCCTCCTGGGGAAAGGCGGG - Intergenic
1026800584 7:73397683-73397705 GCACCCGTCTTGGGAGACGCAGG + Intergenic
1026968573 7:74454663-74454685 CCACCCTGCTGGGGCAATCCTGG - Intronic
1029794338 7:102877989-102878011 GAACACCCCTTGGGAAATGCTGG + Intronic
1031051300 7:116949003-116949025 GCACCCAGTTAGGGAAAGGCAGG + Intergenic
1032518667 7:132525998-132526020 GTACACACCTTGGGAAATGCTGG + Intronic
1033886672 7:145956975-145956997 GCACCCTATTTGGGAACTTCAGG - Intergenic
1035846898 8:2875051-2875073 GCACCCAGCCAGGGAGATGCTGG + Intergenic
1039175244 8:34796666-34796688 GCACAGTGTTTGGGAAATACAGG + Intergenic
1042776854 8:72441703-72441725 GCACCTTGCTTGGGAAGGGAAGG - Intergenic
1042862337 8:73327163-73327185 GGACCCAGCTTGGGGAATGTGGG + Intergenic
1048356660 8:133659473-133659495 GCCTGCTGCTTGGGCAATGCTGG + Intergenic
1048980078 8:139698521-139698543 CCACCCTGCTTAGCACATGCAGG - Intronic
1048986555 8:139738031-139738053 GCACCTGGCTTGGGAGAAGCTGG - Intronic
1052497132 9:29241236-29241258 GTACCATGCTTAGGAAATTCAGG + Intergenic
1055134901 9:72817380-72817402 CCTCCCTGCTTGGAAAATGTAGG - Intronic
1056848083 9:90057687-90057709 GCAGCCTGCTGGGGAAAGGGTGG - Intergenic
1059365861 9:113786004-113786026 GCCCCCTGCATGGGAACTGTGGG - Intergenic
1059765315 9:117378577-117378599 GCCCCCTTCTTGGGAAAAGGTGG + Intronic
1060177963 9:121511372-121511394 CCACCCAGCATGGGAAATGCTGG + Intergenic
1060210439 9:121706951-121706973 GCACCCTGCCTGAGAATTGGGGG + Intronic
1061013346 9:127968125-127968147 ACACCCTGGTTGGGACATCCAGG + Intronic
1061272862 9:129553483-129553505 TCACCCTGCTTGGGAGAGGCAGG - Intergenic
1062564873 9:137159843-137159865 TCACCCTGCCTAGGACATGCCGG + Intronic
1185556890 X:1028718-1028740 GAACCCTGTCCGGGAAATGCTGG + Intergenic
1186351827 X:8747911-8747933 GCACCTTGCTCGGCAAGTGCTGG + Intergenic
1188308611 X:28588900-28588922 GCAGCCAGCTTGGGAAATGCAGG + Intronic
1196344649 X:114639464-114639486 CCTCCATGCTTGGAAAATGCAGG + Intronic
1197112920 X:122797717-122797739 GCCTTCTGCTTGGGAAAAGCAGG + Intergenic
1199734863 X:150676377-150676399 GCACCCTGCTTGGAAATTACTGG - Intergenic
1200967562 Y:9111061-9111083 TCACCCTGGTTGGAGAATGCTGG + Intergenic