ID: 1096148214

View in Genome Browser
Species Human (GRCh38)
Location 12:49293581-49293603
Sequence CAGGACGCACAAAGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096148205_1096148214 -9 Left 1096148205 12:49293567-49293589 CCTGGCCCATCTCACAGGACGCA 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1096148214 12:49293581-49293603 CAGGACGCACAAAGGGGGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 181
1096148204_1096148214 -8 Left 1096148204 12:49293566-49293588 CCCTGGCCCATCTCACAGGACGC 0: 1
1: 0
2: 1
3: 12
4: 153
Right 1096148214 12:49293581-49293603 CAGGACGCACAAAGGGGGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096148214 Original CRISPR CAGGACGCACAAAGGGGGGA GGG Intronic
900353096 1:2246621-2246643 CAGCTCGCACAAAGGAGGGGTGG - Intronic
901480353 1:9520739-9520761 CAGGAAGCACAGGGAGGGGAAGG - Intergenic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902478862 1:16701400-16701422 CAGCACGCACACAGCCGGGAGGG + Intergenic
905124529 1:35707790-35707812 GAGGGCGCACAAAGCAGGGAGGG - Intergenic
905124568 1:35707885-35707907 GAGGAGACACAAAAGGGGGAGGG + Intergenic
911959995 1:104289479-104289501 AAGTACACACTAAGGGGGGAAGG + Intergenic
912554762 1:110508103-110508125 CAGGACTCAGTAAGGAGGGAGGG + Intergenic
915314998 1:155023499-155023521 CAGGAAGCACAGAGGGTGGGTGG - Intronic
917111799 1:171556358-171556380 CAGGAAGCACAAGGGGTGGGGGG - Intronic
921217710 1:212951380-212951402 CAGGACTCACCAAGGGGGAGCGG - Exonic
923296971 1:232603573-232603595 CAGGACCCACAGAGCCGGGAGGG + Intergenic
924432311 1:244007643-244007665 AAGGACACTCAAAGGAGGGACGG - Intergenic
1062862292 10:820116-820138 CAGTACCCACAAAGATGGGAGGG - Intronic
1067209765 10:44250162-44250184 CAGGAAGCACAAGGGGGTCAGGG - Intergenic
1067292851 10:44957048-44957070 CTGGACGCAGAGATGGGGGAAGG - Intergenic
1069832809 10:71291445-71291467 CAGGAGGCACAGAGGGGTGTAGG - Exonic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1074609037 10:115003807-115003829 CAGGAAGCACACAGGTGGGATGG + Intergenic
1077917516 11:6621242-6621264 CAGGAGGCACAGAGGGGTGGTGG - Intergenic
1080260939 11:30349305-30349327 AAGGAAGCAAAAAAGGGGGAAGG - Intergenic
1082063885 11:47883072-47883094 CAGGAGGCAGAAAGGAGTGAGGG + Intergenic
1084526486 11:69701665-69701687 CAAGAGGCACAAAGGGGGCTGGG + Intronic
1084749808 11:71197240-71197262 CAGGCCGGACACTGGGGGGAAGG - Intronic
1084972709 11:72780533-72780555 CAGGGTGCAGAAAGCGGGGAAGG + Intronic
1089820142 11:121218248-121218270 CAGGACTCCAAAAGAGGGGAAGG + Intergenic
1090398498 11:126434263-126434285 CAGGAGCCACCGAGGGGGGAAGG + Intronic
1090973259 11:131660634-131660656 CAGGAAGGAATAAGGGGGGAGGG - Intronic
1094003180 12:25718482-25718504 CAGGAGGCAGATAAGGGGGAAGG + Intergenic
1094422823 12:30289863-30289885 CATGAGGCACAAAGTGGAGAGGG + Intergenic
1096148214 12:49293581-49293603 CAGGACGCACAAAGGGGGGAGGG + Intronic
1096780561 12:53989492-53989514 CACCAGGCACAAAGGGAGGAGGG - Exonic
1096782799 12:54000689-54000711 CAGCAAGCACAAAGAGGAGAAGG + Exonic
1096880052 12:54660036-54660058 TAGGAAGCAAAAAGGTGGGAAGG - Intergenic
1098978570 12:76930648-76930670 CAGGAGGCAGACAGGGGAGAGGG + Intergenic
1099317447 12:81102443-81102465 CAGGAAGCATAAGTGGGGGAGGG + Intronic
1099428307 12:82551146-82551168 CAGGAAGCACAAAAGGGTGGGGG - Intergenic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1104092761 12:125529522-125529544 CAGGACACACAGAGGTGGGAAGG - Intronic
1104556903 12:129808743-129808765 CAGAATGAACAAAGGCGGGAAGG + Intronic
1104721956 12:131049349-131049371 CAGGAGGCACACAGGTGGGGCGG - Intronic
1105436508 13:20383465-20383487 GAGCACGCAGAAAGAGGGGAAGG + Intergenic
1105585028 13:21735872-21735894 CAGGAAGCATAAGGTGGGGATGG + Intergenic
1111961611 13:94816639-94816661 CAGGAAGCAGAAAGGTGGCATGG - Intergenic
1112184327 13:97113647-97113669 CAGGCTGCACAAAAGGGGAAGGG - Intergenic
1114554904 14:23556298-23556320 CGGGACCCACAGAGGGGGAAGGG - Exonic
1114650891 14:24284047-24284069 CAGGACACACTGAGGGGGCAAGG + Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1117047570 14:51828461-51828483 CAGGAGGAAAAAAGGAGGGAAGG + Intronic
1117289274 14:54316764-54316786 CAGGAGGCAGATAAGGGGGAGGG + Intergenic
1119632901 14:76249410-76249432 CAGGAAGCACAAAGGTGGCTGGG - Intronic
1120576350 14:86186069-86186091 CAGGAGGCAGGGAGGGGGGAGGG - Intergenic
1121939819 14:98059423-98059445 CAGGAAGGATAAAGGGGAGAGGG + Intergenic
1122640939 14:103158896-103158918 CAGAACTCACAAAGGGAGGAGGG - Intergenic
1126197690 15:45950294-45950316 CAGGACCCACACAAGTGGGAGGG - Intergenic
1126786339 15:52180187-52180209 GAGGACGCACACAGAGGGAAGGG + Intronic
1128465410 15:67906781-67906803 CAGGAGGCAGAAAGGAGTGAGGG + Intergenic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1130876027 15:88015401-88015423 CAGGAGGCAGACAGGGGGCAGGG - Intronic
1132411222 15:101579446-101579468 AAGGAAACACAAAGTGGGGAAGG + Intergenic
1133119048 16:3595192-3595214 CAGGACCCGCACAGAGGGGAGGG + Intronic
1133663004 16:7937130-7937152 CAGGAAGGACAAAGGGAGAAAGG + Intergenic
1137456351 16:48620905-48620927 CAGGACACACACAGTGGGGAGGG + Intergenic
1141519862 16:84571532-84571554 GAGGAGACACAAAGAGGGGAGGG - Intronic
1142854607 17:2722838-2722860 CAGGACCCACACAGGAGGGATGG + Intergenic
1143903935 17:10195295-10195317 CAGGAAGCATACACGGGGGAGGG - Intronic
1144760011 17:17701791-17701813 TGAGACGCACAAAGGGAGGAGGG - Intronic
1145994746 17:29098909-29098931 CAAGAAGAACAAAGGGGTGAAGG - Exonic
1146478207 17:33180313-33180335 CAGGCCTCACAATGAGGGGAAGG + Intronic
1147446365 17:40477586-40477608 CAGGACGCAGAAAGGATGTAGGG - Exonic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1151378270 17:73706744-73706766 GAGGAAGCAGAAAGGAGGGACGG + Intergenic
1151868075 17:76818065-76818087 CAGGAGGAAGAGAGGGGGGAGGG + Intergenic
1152093228 17:78258274-78258296 CAGGACACACCAAAGGAGGAGGG - Intergenic
1152351053 17:79784319-79784341 GAGGACGCAGAAAGGGGAGCTGG + Exonic
1152609313 17:81307818-81307840 CAGGAAGGAGAAAGGAGGGAAGG - Intergenic
1153784570 18:8523202-8523224 CAGGACGGAAAATGTGGGGAGGG - Intergenic
1154367833 18:13727127-13727149 GAGGACGCACAGAGGCGAGAAGG - Intronic
1155476910 18:26244504-26244526 CAGGAAGCACAAGGGGGTCAGGG - Intronic
1156792515 18:40992810-40992832 CATGAAGGAAAAAGGGGGGAGGG - Intergenic
1157013152 18:43677429-43677451 CAAAACGCACAAAGGAAGGATGG + Intergenic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1165313397 19:35041373-35041395 GAGGACGCAGAAAGGGCGGGGGG + Intronic
1167574280 19:50310299-50310321 GTGGACGCAGAAATGGGGGAAGG - Exonic
1167723124 19:51192525-51192547 CAAGACACACATAGGGAGGAAGG + Intergenic
1167761084 19:51449737-51449759 CAAGACACACATAGGGAGGAAGG - Intergenic
1168307436 19:55443035-55443057 CAGGAGGCAGGAAGGGCGGAGGG + Intergenic
1168555395 19:57334521-57334543 CAGGACACAGAAAGGGGAGTTGG + Intergenic
1202712881 1_KI270714v1_random:27231-27253 CAGCACGCACACAGCCGGGAGGG + Intergenic
925611710 2:5706894-5706916 CAGGACGCACGGAGAGAGGAGGG - Intergenic
928462620 2:31489270-31489292 CAGGAAGCACAAGGGGTGGAGGG + Intergenic
931314685 2:61117519-61117541 CAGGATGCACAAAGAGAAGACGG + Exonic
931902022 2:66800246-66800268 AAGGAAGCACAGAGGGGGTAGGG - Intergenic
934932364 2:98436895-98436917 CAGGAGGCAGATAAGGGGGAAGG + Intergenic
937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG + Intronic
937311049 2:120903766-120903788 CAGGAAGCACAAAGGGGTTTGGG - Intronic
937580006 2:123473831-123473853 CAGGACACTCAAAGAGGGGAGGG - Intergenic
938051621 2:128177978-128178000 CAAGATGCAAAAAGGAGGGATGG - Intronic
938692978 2:133809244-133809266 AAGGAGGCAAAAATGGGGGAGGG + Intergenic
940776527 2:157890397-157890419 CAGGAAGCACAAAAGTGGAAAGG + Intronic
944507235 2:200425138-200425160 CAGGAAGCACAAATGGCGGGGGG - Intronic
945984712 2:216344399-216344421 CATGACTCACAAATGGGGAAGGG + Intronic
946163932 2:217852396-217852418 GAGGAGGCACAAAGGATGGAGGG - Intronic
947178426 2:227390960-227390982 CAGGACACACAATGGTGTGATGG + Intergenic
947483548 2:230525620-230525642 CAGGAAGCACAAGGGGTGGGGGG + Intronic
948055536 2:235007208-235007230 CAGGAGGCACAGAGGGGAGCTGG + Intronic
948865317 2:240772028-240772050 CAGGAGGCACAAAGGTTGGGTGG + Intronic
1168789810 20:568453-568475 CAGGAGTGACAATGGGGGGAAGG - Intergenic
1171284774 20:23928202-23928224 CAGGAGGCACAAGGGAGGGTAGG - Intergenic
1171947022 20:31387791-31387813 CATGACCCAGAAAGGGAGGAGGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172298603 20:33831951-33831973 CAGGAGGCAGCAAGGGGTGAAGG - Intronic
1172870491 20:38132567-38132589 CAAGAGGCACAGAGAGGGGAAGG + Intronic
1174314588 20:49688363-49688385 CAGGACACACCATGGGGGAAGGG + Intronic
1175763133 20:61574488-61574510 CAGGAAGGAGAAAGGGGGGTGGG - Intronic
1176197612 20:63844611-63844633 CAGGACCCCCCAAGGGAGGAGGG - Intergenic
1179825939 21:43966531-43966553 AAGGACGCAGAAAGGAGAGAGGG - Intronic
1184373354 22:44096794-44096816 TATGACGCACAAGGTGGGGAGGG + Intronic
1184414491 22:44344353-44344375 CAGGAAGCACAAAGGAAGCAGGG - Intergenic
949643245 3:6063916-6063938 CAGGAAGAACAAAGGTGGGATGG + Intergenic
949699777 3:6743172-6743194 AAGGATGCAAAAAGGGGAGAAGG - Intergenic
950192889 3:10990457-10990479 CACGAAGGACAAAAGGGGGATGG + Intergenic
950299907 3:11867932-11867954 CAGGAAGCACAAGGGGGCGGAGG - Intergenic
951563886 3:23993624-23993646 CAGGAAGCAGAAATGAGGGAGGG + Intergenic
952519596 3:34143316-34143338 CAGGAAGAACAAGGGGGAGAAGG - Intergenic
955997677 3:64694113-64694135 CAGGAGGCCAAAAGGGGGTATGG + Intergenic
961831072 3:129623323-129623345 CAGGACGGCCACAGGAGGGAAGG + Intergenic
963179240 3:142336565-142336587 AAGGAAGGACAAAGGGGAGAAGG + Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967823372 3:193859001-193859023 CAGGCCCCACAAAGGGAGGCAGG - Intergenic
968442109 4:629294-629316 GAGGAGCCACAAAGGGGTGATGG - Intronic
968488025 4:873590-873612 CAGGCAGCACAAAGGGCAGAAGG - Intronic
968729537 4:2263021-2263043 GAGGACGCCCTAAGTGGGGACGG + Intergenic
968925831 4:3547519-3547541 CAGGAGGCAGAAAGGAGCGAGGG - Intergenic
969471668 4:7392726-7392748 CAGGCATCACAGAGGGGGGAGGG + Intronic
969621829 4:8282549-8282571 CAGGAGGCAGAGAGGGGCGAGGG - Intronic
976473498 4:85455887-85455909 CAAGTCCCACAAAGGGGTGAAGG + Intergenic
977491799 4:97723316-97723338 GAGGACTCCAAAAGGGGGGAGGG + Intronic
981850946 4:149229586-149229608 CAGGAAGCACAAGGGGTTGAGGG + Intergenic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
988315168 5:29617049-29617071 CAGCACACACAAAGGGTGAAAGG + Intergenic
989264901 5:39462217-39462239 CAGGAAGTACCAAGGGAGGATGG - Intronic
993504360 5:88692603-88692625 CAGAAGGCGCAAAGGGGAGAAGG - Intergenic
997215201 5:132104161-132104183 CAGGACTCACCAAGAGAGGAGGG + Intergenic
999383040 5:151135063-151135085 GAGGATGCACAAAGGGAAGAGGG + Intronic
999668476 5:153937251-153937273 CAGGTCGCACAAATGAAGGATGG + Intergenic
999674301 5:153983493-153983515 CAGGATGCACCAAAGGTGGAAGG - Intergenic
999963471 5:156783002-156783024 CAGGAAGCACAAGGGGTTGAGGG + Intergenic
1001575203 5:172758699-172758721 CAGGACCCACCCAGGAGGGAAGG + Intergenic
1002672014 5:180875265-180875287 CAGGACTCAGAAACAGGGGAAGG + Intergenic
1003232458 6:4266955-4266977 AAGGAAGGACAAAGAGGGGAAGG + Intergenic
1005665103 6:28044441-28044463 AAGGAAGAAAAAAGGGGGGAGGG + Intergenic
1005896813 6:30185798-30185820 CAGGACTCTCAATGGGGGGACGG - Exonic
1007007346 6:38378119-38378141 CAGGAGGCAGATAAGGGGGAGGG - Intronic
1008464734 6:51817760-51817782 CAGGAAGCACAAAGATGAGAAGG + Intronic
1009598710 6:65770393-65770415 CATGACACACAAATGGGGGTGGG + Intergenic
1010171848 6:72984646-72984668 CAGGAAGCACAAGGGGTGGGGGG - Intronic
1015097609 6:129434309-129434331 CAGGACTCACAATGAGGGAATGG - Intronic
1018777129 6:167027951-167027973 CAGGACGCACAAAGAGCAGATGG - Intronic
1019127938 6:169853701-169853723 CAGAATGCAAAAAGGGGAGAAGG - Intergenic
1019764148 7:2837190-2837212 CACGAGGCAGAAAGAGGGGATGG + Intronic
1022514339 7:30965853-30965875 CTGAGCGCACAAAGCGGGGAAGG - Intronic
1023164803 7:37332942-37332964 TAGGACGGAAAAAGGGTGGATGG + Intronic
1023845090 7:44116048-44116070 CAGGAGGCACAAAGAAGGGAGGG - Intronic
1024598022 7:50956178-50956200 CAGGACGCAGAGGGAGGGGAAGG + Intergenic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029708312 7:102286777-102286799 CAGGACGCGCGAGGGGGGGCGGG + Intronic
1030791028 7:113729333-113729355 CAGGAGGCAGAAGTGGGGGAAGG - Intergenic
1031586000 7:123532990-123533012 CAGGAGGAAGAAAGGGGGGTTGG + Intronic
1033857113 7:145577546-145577568 CAGGACTCACAAAGGGGTAAAGG - Intergenic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1034257762 7:149733834-149733856 CAGCAGGCACTAAAGGGGGAAGG - Exonic
1037898806 8:22675687-22675709 CAGGAAGGACAACGGGGGGCTGG + Intergenic
1038584667 8:28778067-28778089 CAGGAAGCACACGTGGGGGACGG + Intronic
1039845034 8:41320137-41320159 CAAGAAGCACAAAGGTGGGAAGG + Intergenic
1039915739 8:41859065-41859087 CAGGACGCTGAAAGGGGTCAAGG + Intronic
1040874931 8:52141495-52141517 CAGAGGGCACAAAGTGGGGACGG - Intronic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1049247737 8:141571715-141571737 CAGGAAGCACAAAGGGGCCCTGG + Intergenic
1049849802 8:144824797-144824819 CAGGAGGCAGAAAGGGGGAGAGG - Intergenic
1050929820 9:11308743-11308765 CAGGAGGCAGATAAGGGGGAGGG + Intergenic
1054464169 9:65483097-65483119 CAGGAGGCAGAAAGGAGCGAGGG + Intergenic
1056497259 9:87170514-87170536 CAAGAGGCAGAAAGGGGTGAGGG + Intergenic
1058434887 9:104953328-104953350 CAGGATACACAAAGAAGGGATGG + Intergenic
1059491393 9:114670441-114670463 TAGGACTCACACAGGTGGGAGGG - Intergenic
1059798067 9:117721231-117721253 GAGGACTCAGAAAGGTGGGAAGG - Intergenic
1060507983 9:124212728-124212750 CAGGACACACACATGGGAGAAGG - Intergenic
1061651318 9:132052669-132052691 GAGGACGGAGAAAGGTGGGAGGG - Intronic
1185464468 X:346425-346447 CAGGCCGCGGAAAGCGGGGAGGG + Intronic
1191726907 X:64291453-64291475 CAGCACGCAGAAGGGGAGGAAGG - Intronic
1192202031 X:69072582-69072604 CAGGACACACAAAGGCTGGCTGG + Intergenic
1195810698 X:108825467-108825489 CAGGAAGCACAAGGGGTCGAGGG - Intergenic
1196376658 X:115040241-115040263 CGGGATACAGAAAGGGGGGAGGG + Intergenic
1197468837 X:126841312-126841334 AAGGACGCACACTGGGGGGAAGG + Intergenic
1201586719 Y:15569208-15569230 CAGGCTGAACAAATGGGGGAAGG + Intergenic
1201938673 Y:19435090-19435112 CAGGAAGCACAAAGGGTTGGGGG + Intergenic