ID: 1096148840

View in Genome Browser
Species Human (GRCh38)
Location 12:49296301-49296323
Sequence AGGTGGCATCGGTGGGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 108}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096148819_1096148840 28 Left 1096148819 12:49296250-49296272 CCCCTCTCCGAGTTCAGCCTCCC 0: 1
1: 0
2: 3
3: 134
4: 4239
Right 1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 108
1096148820_1096148840 27 Left 1096148820 12:49296251-49296273 CCCTCTCCGAGTTCAGCCTCCCC 0: 1
1: 0
2: 1
3: 21
4: 288
Right 1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 108
1096148822_1096148840 21 Left 1096148822 12:49296257-49296279 CCGAGTTCAGCCTCCCCACCGCT 0: 1
1: 0
2: 1
3: 37
4: 304
Right 1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 108
1096148825_1096148840 7 Left 1096148825 12:49296271-49296293 CCCACCGCTACCCCCGATCTCAG 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 108
1096148830_1096148840 -4 Left 1096148830 12:49296282-49296304 CCCCGATCTCAGTATCCAGAGGT 0: 1
1: 0
2: 2
3: 9
4: 91
Right 1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 108
1096148828_1096148840 -3 Left 1096148828 12:49296281-49296303 CCCCCGATCTCAGTATCCAGAGG 0: 1
1: 0
2: 0
3: 35
4: 623
Right 1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 108
1096148826_1096148840 6 Left 1096148826 12:49296272-49296294 CCACCGCTACCCCCGATCTCAGT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 108
1096148824_1096148840 8 Left 1096148824 12:49296270-49296292 CCCCACCGCTACCCCCGATCTCA 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 108
1096148821_1096148840 26 Left 1096148821 12:49296252-49296274 CCTCTCCGAGTTCAGCCTCCCCA 0: 1
1: 0
2: 1
3: 22
4: 325
Right 1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 108
1096148827_1096148840 3 Left 1096148827 12:49296275-49296297 CCGCTACCCCCGATCTCAGTATC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 108
1096148823_1096148840 11 Left 1096148823 12:49296267-49296289 CCTCCCCACCGCTACCCCCGATC 0: 1
1: 0
2: 1
3: 28
4: 338
Right 1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 108
1096148831_1096148840 -5 Left 1096148831 12:49296283-49296305 CCCGATCTCAGTATCCAGAGGTG 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 108
1096148832_1096148840 -6 Left 1096148832 12:49296284-49296306 CCGATCTCAGTATCCAGAGGTGG 0: 1
1: 0
2: 1
3: 21
4: 269
Right 1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096148840 Original CRISPR AGGTGGCATCGGTGGGCGCG GGG Intronic
900548513 1:3241893-3241915 GGGTGGCATCGGTGGGTGGCTGG + Intronic
901628950 1:10638950-10638972 AGGAGGCTGCAGTGGGCGCGGGG + Exonic
916557108 1:165902700-165902722 AGGGGGCATGGGTGGGAGCTGGG + Intronic
917793147 1:178512738-178512760 AGGTGGGGTCGGTTCGCGCGAGG + Intergenic
922573423 1:226646828-226646850 AGGTGGGATCGCTGGGGGTGCGG - Intronic
922809845 1:228409336-228409358 CAGTGGCAGCGGTGGGCGGGGGG - Intronic
1063124011 10:3124316-3124338 AGGTGGGAACAGTGGGCGTGTGG + Intronic
1063925512 10:10973442-10973464 ACCTGGCATGGGTGGGCGTGAGG - Intergenic
1068776370 10:60872555-60872577 AGGTGGCAGGGGAGGGCGGGAGG - Intronic
1069625199 10:69863453-69863475 AGGAGGCATGGGTGGGGGCTAGG + Intronic
1072662313 10:97370522-97370544 AGGAGGTGTCGGTGGGCGCACGG - Exonic
1073284993 10:102382249-102382271 AGGTGGCCTCGATGAGCGCAGGG - Exonic
1076407178 10:130220361-130220383 AGTTGGGACCAGTGGGCGCGAGG + Intergenic
1076781174 10:132725424-132725446 AGGTGTCAGCGGTGGCGGCGGGG + Intronic
1077272782 11:1689657-1689679 AGGCAGCATGGGTGGGCGCTGGG - Intergenic
1078529597 11:12126810-12126832 AGGAGGCAGCGGTGGGTGTGGGG + Intronic
1083271767 11:61576406-61576428 AGGTGGCATATGTGGCCGAGAGG - Intronic
1083428734 11:62602715-62602737 GGGTGGGACCGGTGGGCCCGAGG - Intronic
1085045868 11:73353084-73353106 AGGTGGGATGGGTGGGGGTGGGG - Intronic
1085518451 11:77124621-77124643 AGGTGGCGTCAGTGGGGGTGAGG + Exonic
1087799658 11:102489668-102489690 AGGTGGCAGGGGTGGGGGCTGGG + Intronic
1094850442 12:34380005-34380027 AGCTGGCACCTGTGGGCTCGAGG + Intergenic
1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG + Intronic
1096302031 12:50438206-50438228 AGGAGGCAGGGCTGGGCGCGGGG + Intronic
1102555644 12:113724891-113724913 GGGTGGCTGCGGTGGGGGCGGGG - Intergenic
1105021851 12:132822018-132822040 AGGTGGCACCAGTGGGCCCGGGG + Exonic
1111445825 13:88345423-88345445 AGGTGGCACGGGGGGGTGCGCGG + Intergenic
1113697177 13:112354767-112354789 AGGTGGCATCTGAGGGCACAGGG + Intergenic
1113777220 13:112954634-112954656 AGGGGGCATGGGTGGGCTCAGGG + Intronic
1121728520 14:96170399-96170421 AGGTGTCAGGGGTGGGGGCGTGG - Intergenic
1122736907 14:103848241-103848263 AGGTGGCACAGGTGGGCGCGGGG - Intergenic
1127763484 15:62164119-62164141 AGGCGGCAGCGGACGGCGCGGGG + Exonic
1128028745 15:64461030-64461052 AGGGGGCGTCGAGGGGCGCGGGG + Intronic
1132552776 16:560249-560271 AGGGGGCGGCGGGGGGCGCGCGG + Intergenic
1132761805 16:1512136-1512158 AGGCGGCATAGGTGGGTGAGGGG + Intronic
1132761828 16:1512187-1512209 AGGCGGCATAGGTGGGTGGGGGG + Intronic
1134108143 16:11498763-11498785 AGGTGGCATCGATCGGCTTGTGG - Intronic
1139492413 16:67293420-67293442 AGATGGCATTGGTGAGCGGGGGG + Intronic
1140793720 16:78415815-78415837 AGGTGGTAGTGGTGGGGGCGGGG - Intronic
1142261036 16:89042540-89042562 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261046 16:89042573-89042595 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261056 16:89042606-89042628 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261066 16:89042639-89042661 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261076 16:89042672-89042694 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1147759023 17:42785569-42785591 GGGTGGCAGCGATGGGGGCGGGG + Intronic
1148603034 17:48908526-48908548 AGGCGGCAACGGCGGGCGCCGGG + Exonic
1151612112 17:75182933-75182955 AGGCGGCAGCGGTGGACGAGGGG + Intergenic
1152192508 17:78897160-78897182 CTGTGGCATCGGGGGGCGGGGGG + Intronic
1152724341 17:81937632-81937654 AGCTGGCGTCCCTGGGCGCGCGG + Intronic
1152809509 17:82374937-82374959 AGGTAGGCGCGGTGGGCGCGCGG - Exonic
1153728404 18:7981162-7981184 AGGTGGGGTTGGTGGGCGGGGGG - Intronic
1154377911 18:13824064-13824086 AGGTGGCAGCGGAGGCCGCCCGG + Intergenic
1160891302 19:1380060-1380082 AGGTGGCCTTGGTGGCCGCACGG + Intergenic
1161228972 19:3163039-3163061 AGGCGGCACCGGCGGGCGGGTGG + Exonic
1161956942 19:7501375-7501397 AGGTGGCAACTGGGCGCGCGAGG - Exonic
1161960202 19:7519152-7519174 AGGTGGGTTCTGTGGGAGCGGGG - Intronic
1165390036 19:35533599-35533621 GGGAGGCAGCGGAGGGCGCGGGG + Intronic
1165817097 19:38648869-38648891 AGGTGAGATCGGTGGGAGGGAGG + Intronic
1166109416 19:40613308-40613330 ACCTGGCATTGGTGGGGGCGGGG + Intronic
1166766026 19:45252310-45252332 AGGTGGCATCTGGGGGCCCCGGG - Intronic
1167115014 19:47484043-47484065 AGGCGGCGCCGGCGGGCGCGGGG - Exonic
1167601160 19:50455601-50455623 AGGTGGCATCGATGGGTACCTGG + Exonic
1167946732 19:52994104-52994126 AGGGGGCGTGGGAGGGCGCGGGG + Intergenic
1168293862 19:55369610-55369632 AGCTGGCGGCGGGGGGCGCGGGG + Intronic
925265430 2:2563398-2563420 AGGTGACATAGGTGGGCAGGTGG + Intergenic
925331229 2:3060185-3060207 GGCTGTCATCGGTGGGAGCGTGG + Intergenic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
936041522 2:109153778-109153800 TGGTGGCATCGGGGGTCGGGGGG - Intronic
945929501 2:215840858-215840880 AGGTGGGATCGGTGGGCAGTAGG - Intergenic
947721137 2:232369883-232369905 AGGTGGGATCTGTGGGTGCTTGG - Intergenic
947987801 2:234463780-234463802 AGGTGGCATAAGTAGGCCCGTGG - Intergenic
948992643 2:241562582-241562604 AGATGGCACCGGTGGGCACTGGG - Intronic
1171439211 20:25147595-25147617 AGGTGGCATCAGTGGATGGGTGG - Intergenic
1176042325 20:63072232-63072254 GGGAGGGGTCGGTGGGCGCGCGG - Intergenic
1181813810 22:25421498-25421520 ATGGGGCATCGGAGGGCGGGTGG + Intergenic
1183352982 22:37344057-37344079 AGGGGGCATGGGTGGGGGCATGG - Intergenic
1184658849 22:45956012-45956034 AGGTGGCTGCGGTGGGGGTGAGG + Intronic
954223024 3:49166109-49166131 GGGTGGGGTCGCTGGGCGCGGGG + Intronic
954371054 3:50169783-50169805 AGGTGGCATCAGTGGGGGCCAGG - Intronic
954632517 3:52055218-52055240 AGGTAGCACCGGGGGGCGAGTGG - Intronic
954686574 3:52373299-52373321 AGGTGGCGGTGGTGGCCGCGGGG + Intronic
955400337 3:58586888-58586910 CGGTGGCATCGGAGGGCCCCCGG + Intronic
961651393 3:128418346-128418368 AGGAGGCACAGGTGGGTGCGTGG - Intergenic
961703422 3:128765034-128765056 AGGTGGCGGCGGTGGCTGCGCGG + Intronic
969604623 4:8196362-8196384 AGGTGGCACTGGTGGGGACGTGG + Intronic
969672839 4:8599105-8599127 AGGTGGCATCTGTGAGTGCTGGG - Intronic
971294483 4:25376929-25376951 TGGTGGGATCGCTGGGCGCCGGG - Intergenic
973782985 4:54307028-54307050 AGGAGGCATGGGAGGGGGCGAGG + Intergenic
976092390 4:81471810-81471832 TGGTCGCATTTGTGGGCGCGCGG - Exonic
993463641 5:88217559-88217581 TGGCGGCAGCGGTGGGCGAGGGG + Intronic
994793887 5:104268372-104268394 AGGTGGAAGCGGTGGGAGAGAGG - Intergenic
999881080 5:155864412-155864434 GGGTGACATCGGTGGAGGCGGGG + Intergenic
1002660485 5:180788182-180788204 AGGTGGCATGCGTGTGTGCGTGG - Intergenic
1010044081 6:71420446-71420468 CGGTGGCACCGGCGGGCGCGGGG + Intergenic
1017962133 6:159232378-159232400 AGGTGCCCTGGGTGGACGCGTGG - Exonic
1021668692 7:23013744-23013766 AGGCGCCATGGGTGGGTGCGAGG - Intronic
1029423895 7:100485168-100485190 AGGTGGGATGGGTGGGGGCCAGG - Intronic
1030687836 7:112504922-112504944 AGGTGGCATGGGTGGTGGTGAGG + Intergenic
1035768209 8:2125853-2125875 GGGAGGCCTCGGTGGGCGGGCGG - Intronic
1038490225 8:27965392-27965414 AGGTGGAGTTGGTGGGAGCGAGG - Intronic
1039180184 8:34858306-34858328 AGAAAGCATCGGTGGGGGCGGGG - Intergenic
1040289445 8:46116823-46116845 AGGTGGCATGGGCGGGCCCTTGG - Intergenic
1049317522 8:141977242-141977264 AGGTGGCATCTGAGGGAGCAGGG + Intergenic
1049423849 8:142528599-142528621 AGGTGGCATCGGCGGCAGAGAGG - Intronic
1052369871 9:27651924-27651946 AGGTGGCATGAGTGGGTGGGTGG + Intergenic
1056773764 9:89497581-89497603 AGGTGGCTCCTCTGGGCGCGGGG - Intronic
1059172914 9:112143480-112143502 ATGTGGCATCGGTGGTCGGGTGG + Exonic
1061570907 9:131476919-131476941 AGGGGGCATCGCTGGCCTCGTGG + Intronic
1062149400 9:135009837-135009859 AGGGGGAGTCGGTGGGCGCCTGG - Intergenic
1062435807 9:136546118-136546140 AGGTGGCCGCGGAGGGGGCGGGG - Intergenic
1189352984 X:40290926-40290948 AGGGGGCATCTGAGGGCACGAGG + Intergenic
1192795188 X:74420610-74420632 AGGTGGCACCAGTGGGGGCCGGG - Intergenic
1196765146 X:119236190-119236212 AGGTGGCCTCGGGGGAGGCGGGG + Intergenic
1199832938 X:151562802-151562824 AGGGGGCAGCGGGGGGGGCGGGG + Intergenic
1201291245 Y:12421786-12421808 AGGGGGCCGCGGTGGGCGAGGGG - Intergenic