ID: 1096154285

View in Genome Browser
Species Human (GRCh38)
Location 12:49333162-49333184
Sequence GTGCAGAATGACGCTGTTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 86}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096154281_1096154285 -4 Left 1096154281 12:49333143-49333165 CCTCGTCGCCCACGTCCAGGTGC 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1096154285 12:49333162-49333184 GTGCAGAATGACGCTGTTGCTGG 0: 1
1: 0
2: 1
3: 3
4: 86
1096154275_1096154285 30 Left 1096154275 12:49333109-49333131 CCGTGCACTTTCCCGCCGTCCAG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1096154285 12:49333162-49333184 GTGCAGAATGACGCTGTTGCTGG 0: 1
1: 0
2: 1
3: 3
4: 86
1096154279_1096154285 11 Left 1096154279 12:49333128-49333150 CCAGCTTGATGAAGACCTCGTCG 0: 2
1: 0
2: 0
3: 4
4: 37
Right 1096154285 12:49333162-49333184 GTGCAGAATGACGCTGTTGCTGG 0: 1
1: 0
2: 1
3: 3
4: 86
1096154278_1096154285 15 Left 1096154278 12:49333124-49333146 CCGTCCAGCTTGATGAAGACCTC 0: 2
1: 0
2: 0
3: 6
4: 124
Right 1096154285 12:49333162-49333184 GTGCAGAATGACGCTGTTGCTGG 0: 1
1: 0
2: 1
3: 3
4: 86
1096154276_1096154285 19 Left 1096154276 12:49333120-49333142 CCCGCCGTCCAGCTTGATGAAGA 0: 1
1: 0
2: 1
3: 8
4: 78
Right 1096154285 12:49333162-49333184 GTGCAGAATGACGCTGTTGCTGG 0: 1
1: 0
2: 1
3: 3
4: 86
1096154277_1096154285 18 Left 1096154277 12:49333121-49333143 CCGCCGTCCAGCTTGATGAAGAC 0: 1
1: 1
2: 0
3: 6
4: 69
Right 1096154285 12:49333162-49333184 GTGCAGAATGACGCTGTTGCTGG 0: 1
1: 0
2: 1
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096154285 Original CRISPR GTGCAGAATGACGCTGTTGC TGG Exonic
902567253 1:17320192-17320214 GATCAGAGTGATGCTGTTGCTGG - Intronic
903604079 1:24562205-24562227 GTGACGAATGACGCTGTTACTGG - Intronic
907462188 1:54611723-54611745 GTACAGCCTGACGCTGTGGCAGG - Exonic
913053163 1:115134469-115134491 CTGCAGGATCACGATGTTGCGGG + Intergenic
924577251 1:245291860-245291882 GTGCAGAAGGGCCCTGGTGCAGG + Intronic
1064004351 10:11688305-11688327 CTGCAGAATGCCCCTGTGGCAGG + Intergenic
1065760822 10:28981801-28981823 ATGCAGTATTATGCTGTTGCGGG - Intergenic
1072258667 10:93646020-93646042 GTACAGTAAGACTCTGTTGCAGG + Exonic
1079160661 11:17990343-17990365 CTGCAGAATGTCAATGTTGCAGG - Intronic
1092807962 12:12244433-12244455 GTGCAGAATGTTGTTGTTTCTGG - Exonic
1096154285 12:49333162-49333184 GTGCAGAATGACGCTGTTGCTGG + Exonic
1104169758 12:126268745-126268767 GAGCAGAATTAAGCTGTTCCTGG - Intergenic
1105587920 13:21761670-21761692 GTGCAGTAAGAGGCTGTTGTTGG - Intergenic
1108321021 13:49290604-49290626 GGGCAGAAAGAAGCTTTTGCAGG + Intronic
1112280170 13:98056024-98056046 GTACAGAAGGAGGCTGTGGCTGG + Intergenic
1114393499 14:22335611-22335633 GTGCTAAATGCTGCTGTTGCTGG - Intergenic
1114419040 14:22564618-22564640 GTGCATAATGATGCAGTTCCAGG + Intergenic
1118953590 14:70458363-70458385 GTGCAGCATCATGCTGTAGCTGG - Exonic
1121017113 14:90555581-90555603 CGGCAGAATGGCGCTGGTGCAGG - Intronic
1122060763 14:99135303-99135325 CTGCAGAATGATGCTGTTGGAGG - Intergenic
1125568765 15:40698115-40698137 GAGGAGAATGCAGCTGTTGCAGG - Intronic
1130094773 15:80847778-80847800 GTGCAGAAGGGCGCTGTGGGTGG + Intronic
1132105551 15:99059862-99059884 GGGCAGGAGGACGCTGTGGCCGG - Intergenic
1135460565 16:22638783-22638805 TTGCATAATGACGCTCCTGCTGG - Intergenic
1135494841 16:22942370-22942392 GGGCATAATGACGGAGTTGCCGG - Intergenic
1138888739 16:61114855-61114877 GATGAGAATGATGCTGTTGCTGG + Intergenic
1141474135 16:84260819-84260841 ATGAAGCATGACGATGTTGCAGG + Intergenic
1141911380 16:87060757-87060779 GTGCAGATGGACGCACTTGCTGG + Intergenic
1143778872 17:9218960-9218982 GTGCCGAGTGACGTTCTTGCAGG - Intronic
1145259276 17:21345151-21345173 GTGCAGAAAGATTCTGGTGCTGG + Intergenic
1145317339 17:21742798-21742820 GTGCAGAAAGATTCTGGTGCTGG - Intergenic
1148079577 17:44960296-44960318 GTGCAGGATCACGCTGTTGCTGG + Exonic
1149993628 17:61396187-61396209 GTGCAGAACGACGCCCTTCCAGG + Intergenic
1155237642 18:23836923-23836945 GTGCAGAATGAGGGAGATGCCGG + Intronic
1155443285 18:25884373-25884395 CTGCACAATGCCGCTGCTGCTGG - Intergenic
1160834863 19:1119854-1119876 AGGCAGAAAGACGCTGCTGCGGG + Intronic
1161025973 19:2037391-2037413 GTGCAAAACCACGTTGTTGCTGG - Intergenic
1161469249 19:4448099-4448121 GTGCAAAATGAAGGTGTTGAAGG - Intronic
1166533338 19:43555526-43555548 GGGCTGAATGAGGCTGTTTCTGG - Intronic
1166988263 19:46675203-46675225 GTGCAGAAGGAAGGTGTTGATGG - Intronic
925428293 2:3769468-3769490 GTGAAGGATGACGCTGAGGCGGG - Intronic
926632979 2:15154347-15154369 GGGGAGAATGATGCTGTAGCGGG + Intergenic
926671710 2:15582888-15582910 GTGCAAAATGGCTCTGTCGCAGG + Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
929884246 2:45864139-45864161 GAGCAGAATGACGCTCTTTGAGG - Intronic
935046578 2:99489285-99489307 GTGCGGAAAAACGCTGTGGCTGG + Intronic
937083543 2:119156910-119156932 GTGCAGCACCACGCTGTTACTGG + Exonic
945483826 2:210370909-210370931 GTGCAGGATGCTGCTGCTGCTGG - Intergenic
947535938 2:230940505-230940527 GTCCAGAATGACGCTGTCTTCGG - Intronic
1179678698 21:43002493-43002515 CTCCAGAATGACGCTGTTGAGGG + Intronic
1180057170 21:45364985-45365007 GTGGAGAATGAGGCTGTGGGCGG + Intergenic
1180767288 22:18352481-18352503 GGCCAGGATGACGCTGTAGCAGG - Intergenic
1180779021 22:18509898-18509920 GGCCAGGATGACGCTGTAGCAGG + Intergenic
1180811742 22:18767218-18767240 GGCCAGGATGACGCTGTAGCAGG + Intergenic
1181197895 22:21201460-21201482 GGCCAGGATGACGCTGTAGCAGG + Intergenic
1182923610 22:34102723-34102745 GTGCAGGATGAAGCTGTCCCTGG + Intergenic
1183290379 22:36998453-36998475 TTGCAAAATGAGGCTGTTTCTGG - Intronic
1203228910 22_KI270731v1_random:93375-93397 GGCCAGGATGACGCTGTAGCAGG - Intergenic
952288954 3:31996637-31996659 TTTCAGAAAGAAGCTGTTGCCGG + Intronic
952976284 3:38699045-38699067 GTGAAGATTGACTCTGTTTCTGG + Intronic
955043904 3:55341934-55341956 CTGGAGAATGTCACTGTTGCTGG - Intergenic
960402864 3:117225097-117225119 GTGCAGAATGACTTGGTTTCTGG - Intergenic
966761757 3:183425561-183425583 GTGAAGGCTGAGGCTGTTGCAGG + Intronic
968089574 3:195891945-195891967 GTGCAGAGCTGCGCTGTTGCTGG - Intronic
969312868 4:6364261-6364283 GTGCAAAATGGCTCTGCTGCAGG + Intronic
975809281 4:78149446-78149468 GTGAAGAATGAGACTGGTGCTGG - Intronic
976381291 4:84402135-84402157 TTGAAGAATGGCACTGTTGCGGG - Intergenic
982716153 4:158810758-158810780 GTCCAGAATGACAGTGTTCCAGG + Intronic
993540759 5:89148237-89148259 GTGCAGAATGAGGCTGTATGTGG - Intergenic
993991225 5:94660738-94660760 GTGCATGACGACGCTGGTGCTGG + Intronic
995022203 5:107379718-107379740 ATGCAGGATGACCCTGTTGAAGG - Exonic
998335860 5:141371695-141371717 GTGCAGAGTGATGGTCTTGCTGG - Exonic
1002665919 5:180824873-180824895 GTGCTGAATGCAGCTGTTGAAGG - Intergenic
1017985290 6:159438248-159438270 GTGCAGGATCAGGCTGATGCAGG + Intergenic
1018794673 6:167176544-167176566 CTGCAGGATCACGCTGTTCCAGG + Intronic
1018821647 6:167378523-167378545 CTGCAGGATCACGCTGTTCCAGG - Intronic
1019151123 6:170006644-170006666 GAGCGGGATGACTCTGTTGCTGG - Intergenic
1019592613 7:1843217-1843239 CTGCAGAATGATGCTCTTTCTGG + Intronic
1023579820 7:41669902-41669924 GTGCAGAAGGACTATGTGGCAGG + Intergenic
1033652583 7:143354003-143354025 GTGCAGGAAGAGGCTGTTTCGGG - Exonic
1034478925 7:151304889-151304911 GTTTAGAATCACGCTGTTACAGG + Intergenic
1035762643 8:2080895-2080917 GTGCAGAATGAGGTTGGTTCTGG + Intronic
1036127496 8:6076338-6076360 GTGCAGATTGCCTTTGTTGCAGG + Intergenic
1036777901 8:11626033-11626055 CTGCAGAATGGCGCTGCTGTGGG + Intergenic
1037805873 8:22057649-22057671 GTGAAGAGTGAGGCTGTGGCAGG + Intronic
1039476565 8:37841985-37842007 GTGCAGACTGCCGCTCTCGCTGG - Exonic
1045264261 8:100605595-100605617 GTTCAGAAGGATGCGGTTGCTGG + Intronic
1048446532 8:134497385-134497407 GTGCAGGATGCCCCTGCTGCTGG + Intronic
1188400016 X:29732720-29732742 TTGGAGAATGTCTCTGTTGCTGG + Intronic
1193905322 X:87236947-87236969 CTGCAGCATGATGCTCTTGCTGG - Intergenic
1201460185 Y:14213867-14213889 GGGCAGAAGGAAGCTGTTTCTGG + Intergenic