ID: 1096155691

View in Genome Browser
Species Human (GRCh38)
Location 12:49340170-49340192
Sequence ACACCTAGCTATAGCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096155691_1096155696 6 Left 1096155691 12:49340170-49340192 CCCCCAGGGCTATAGCTAGGTGT 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1096155696 12:49340199-49340221 GAGTTCTGAGGACCAGACTTTGG 0: 1
1: 0
2: 1
3: 19
4: 200
1096155691_1096155695 -6 Left 1096155691 12:49340170-49340192 CCCCCAGGGCTATAGCTAGGTGT 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1096155695 12:49340187-49340209 AGGTGTGTGTCAGAGTTCTGAGG 0: 1
1: 0
2: 1
3: 30
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096155691 Original CRISPR ACACCTAGCTATAGCCCTGG GGG (reversed) Intergenic