ID: 1096155863

View in Genome Browser
Species Human (GRCh38)
Location 12:49341301-49341323
Sequence GGCTGTTCTCCGACTGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096155863 Original CRISPR GGCTGTTCTCCGACTGCAGC TGG Intergenic
900300749 1:1975920-1975942 GGGTGTTTTCCTACAGCAGCAGG - Intronic
900609934 1:3540356-3540378 GGCTGTCTTCCCAGTGCAGCGGG - Intronic
901236137 1:7668591-7668613 GGCTCTTCTGCTGCTGCAGCAGG - Intronic
906040537 1:42785126-42785148 GGCTGGTCGCCGACAGCACCCGG - Intronic
907048816 1:51316117-51316139 GGCTGTTCTCAGGGTCCAGCAGG - Intronic
907237241 1:53061270-53061292 GGCTGTCCTCCCACTGAAGAGGG - Intergenic
907487982 1:54790163-54790185 GGCTGGTCTTGGACTGCTGCTGG - Intronic
911164094 1:94709749-94709771 AGCTGTCCTCAAACTGCAGCAGG - Intergenic
916727974 1:167540291-167540313 ATCTGTTCTCCTTCTGCAGCAGG + Intronic
924755286 1:246934978-246935000 GTCTGTGCTCCCAGTGCAGCTGG - Intergenic
1064107546 10:12512828-12512850 GGGTGTTCTGAGACTGCAACAGG + Intronic
1065135115 10:22659903-22659925 GGCTGTTTTCAGACTGAGGCAGG + Intronic
1067726423 10:48774502-48774524 GGTTCTTCTCCGACTTCACCAGG - Exonic
1067941241 10:50659063-50659085 GGCTGTTCTCCATCTCCCGCTGG - Intergenic
1070862463 10:79683935-79683957 GGCTGTTCTCCATCTCCCGCTGG - Intergenic
1073074759 10:100816850-100816872 GGCTGTTCTCCGAGCCCTGCAGG - Intronic
1073180223 10:101579012-101579034 GGCTGTTCTCCTACCCCAGAGGG + Exonic
1073864291 10:107784539-107784561 ATCTGTTCCCCGAGTGCAGCTGG - Intergenic
1074146391 10:110720762-110720784 GCCTGCTCTCCCACAGCAGCTGG + Intronic
1075112332 10:119597200-119597222 GGCTGTCCTCGGACTGCTCCAGG + Intergenic
1076779382 10:132715765-132715787 AGCTGTTCTCCGAGGCCAGCGGG - Intronic
1076806090 10:132859585-132859607 GGCTGTTCACACGCTGCAGCTGG + Intronic
1077059014 11:609674-609696 CGCTGCTCTCCGACTCCTGCAGG - Exonic
1088927380 11:114316027-114316049 GTCTGTTCTCCGACGGAAGCCGG + Intergenic
1091061485 11:132467142-132467164 GTCTGTTATCAGCCTGCAGCAGG - Intronic
1093072767 12:14724058-14724080 GCCAGTTCCCCAACTGCAGCAGG + Intergenic
1096155863 12:49341301-49341323 GGCTGTTCTCCGACTGCAGCTGG + Intergenic
1096648958 12:53052727-53052749 TGCTGTGCCCAGACTGCAGCTGG + Intronic
1100659629 12:96682769-96682791 GGCTGTTCTGTCACTGCTGCAGG - Intronic
1103798765 12:123523561-123523583 GCTTGTTCTCCTCCTGCAGCTGG + Exonic
1104895254 12:132160817-132160839 GGCTGTCCTCCGACACCAGCTGG - Intergenic
1105849873 13:24323783-24323805 GGCTGGTCTCTGAGTGCAGGTGG + Intergenic
1111123330 13:83881186-83881208 GGCTTTTCTGGGGCTGCAGCTGG - Exonic
1117156060 14:52942777-52942799 AGCTGTTCTCAGACTGTAGTAGG - Intronic
1117453879 14:55878532-55878554 GGCTTGTCTCCGGCTGCACCAGG + Intergenic
1118729771 14:68658188-68658210 GGCTGTCCTCAGAGAGCAGCTGG - Intronic
1119444031 14:74648719-74648741 GGCTGCTGTCGGAATGCAGCTGG + Intergenic
1121335763 14:93076750-93076772 GGCTGTTCTGGGACAGTAGCAGG - Intronic
1122488374 14:102096473-102096495 GGTTGTTCTCCAAATGCACCTGG + Intronic
1122734489 14:103829469-103829491 GGCTGGTCTCAGACTGCTGCTGG + Intronic
1123169358 14:106356665-106356687 GGCTGTTCTCCCAGAGCTGCAGG + Intergenic
1124374416 15:29121287-29121309 GGGTGTTCTCCTCATGCAGCCGG - Exonic
1128749806 15:70140781-70140803 AGGGGTTTTCCGACTGCAGCTGG + Intergenic
1131531895 15:93200794-93200816 GTCTCTTCTCTGACTGGAGCTGG + Intergenic
1132092264 15:98956236-98956258 GGCTGGGCTCCGACAGCACCTGG - Intronic
1137504105 16:49036041-49036063 GCCTTTTCTTCCACTGCAGCAGG + Intergenic
1137542686 16:49376095-49376117 GGCAGGTCTCCGACAGCAGCAGG + Intronic
1139724395 16:68884998-68885020 TCCTGTTTTCCCACTGCAGCTGG - Intronic
1140057356 16:71537043-71537065 GGCTGTTCTCCCACTGAAAGAGG - Exonic
1140205364 16:72928463-72928485 GGCTGTTCTCTGGCAGCACCCGG + Intronic
1140433152 16:74922046-74922068 GGCTGTTTTCCCTCCGCAGCTGG + Exonic
1141509150 16:84501440-84501462 TGCTGTTCTCCGACCACAGTGGG - Intronic
1142039291 16:87882203-87882225 GGCTGTTCTCAGAGCGCTGCAGG + Exonic
1142088101 16:88195135-88195157 GCCTGTTCTCAGAATACAGCTGG + Intergenic
1142320428 16:89379003-89379025 GGCTTGTCTACGACTGCAGGAGG - Intronic
1142918436 17:3163069-3163091 TGCTGTACCCCAACTGCAGCAGG + Intergenic
1144224708 17:13133659-13133681 CACTGTTCTCCAAATGCAGCTGG + Intergenic
1144481044 17:15629130-15629152 TGCGGTTCTCCTCCTGCAGCCGG + Exonic
1144775680 17:17783474-17783496 GGATTTTCTCCGGCAGCAGCAGG + Intronic
1144917321 17:18734923-18734945 TGCGGTTCTCCTCCTGCAGCCGG - Exonic
1148110440 17:45141833-45141855 GGATATTCTCCGACTGCAGGAGG - Intronic
1151389621 17:73777309-73777331 TGCTTTTCTCCGGCTCCAGCTGG + Intergenic
1152915319 17:83031687-83031709 GGCTCCACTCTGACTGCAGCAGG + Intronic
1155043164 18:22082101-22082123 AGCGGTTCTCCTGCTGCAGCTGG + Intergenic
1160439067 18:78875263-78875285 GGCAGTTCTCCAGCTGCAGGAGG + Intergenic
1160498571 18:79389870-79389892 GGCTGTTATCCCACTGCCTCAGG - Intergenic
1161496851 19:4591215-4591237 GCCTGCTCTGCGACTGCAGGGGG + Intergenic
1161518877 19:4712633-4712655 GGCTGTTCTCAAGCTACAGCAGG - Intronic
1163363442 19:16862525-16862547 GGCTGTCCTCCCACTGCACTTGG - Exonic
1163873770 19:19848284-19848306 GGCTGGTCTCCAACTCCAGACGG - Intergenic
1166705435 19:44905674-44905696 GGCTGTTCTCCCCCTGCCCCAGG - Intergenic
925204505 2:1994674-1994696 GGCTGTTCTGAGACTACATCTGG + Intronic
928965220 2:36968934-36968956 GGCTGTTCTCCAACTGTTACCGG - Intronic
929804419 2:45132268-45132290 GGCTCCTCTGCCACTGCAGCGGG - Intergenic
932592589 2:73076098-73076120 GGCTATGCTCAGACTGGAGCGGG + Exonic
935098499 2:99970002-99970024 TGCTGCTCTCCGAATGCTGCAGG + Intronic
935389476 2:102535452-102535474 GGCATTTCTACCACTGCAGCAGG - Intergenic
939284059 2:140106109-140106131 GGCTGTTCTCCCACTTAAGTGGG + Intergenic
939377087 2:141382385-141382407 GGCAGTTCTCTGAGTGTAGCAGG - Intronic
946432104 2:219631474-219631496 GGCCTTTCCCCGACTGCTGCTGG + Intronic
946679845 2:222202062-222202084 GTCTAGTCTCTGACTGCAGCTGG + Exonic
947871176 2:233439416-233439438 GACTGCTCTCCGACTGCGCCTGG - Intronic
948495380 2:238345434-238345456 GGCTGGGATGCGACTGCAGCAGG + Intronic
1171008876 20:21495849-21495871 GGCTGTTCTAGGCCTGCAGTGGG + Intergenic
1171299358 20:24046107-24046129 GGCTGTCCTCCGCCTGCCGTGGG - Intergenic
1172303976 20:33868680-33868702 GGTTGTTCTCAGACTGCATGAGG + Intergenic
1173789513 20:45818703-45818725 GGCTTTCTTCCGTCTGCAGCGGG - Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1175811951 20:61863266-61863288 GGCTGTTCCTCACCTGCAGCCGG + Intronic
1176261218 20:64181764-64181786 GGCAGTTCTCAGACTGCGGTGGG + Intronic
1176289568 21:5036958-5036980 GGCTGTTCCTCGGCTTCAGCGGG + Intronic
1178844978 21:36167141-36167163 GGCTGTTCTTAGACTCCAGGAGG - Intronic
1179867662 21:44226629-44226651 GGCTGTTCCTCGGCTTCAGCGGG - Intronic
1181038575 22:20181517-20181539 GGCAGGTGTCCCACTGCAGCTGG - Intergenic
1183749736 22:39713070-39713092 AGCTATTCACCCACTGCAGCGGG + Intergenic
1184003252 22:41690540-41690562 GGCGGCTATCCTACTGCAGCTGG + Exonic
952886528 3:38015870-38015892 GACTGGTCTCCCATTGCAGCAGG + Intronic
953360825 3:42294853-42294875 GGCCCTTCCCAGACTGCAGCAGG + Intergenic
953853695 3:46484936-46484958 GGCTCTGCTCCGAGAGCAGCCGG - Intronic
954218558 3:49138171-49138193 GGCTCTGCTCCCACTGCAGCTGG - Intergenic
956802018 3:72768227-72768249 AGCTCTTCTCTGCCTGCAGCAGG - Intronic
961355730 3:126338952-126338974 GGCTGTTCTCAGAACCCAGCCGG - Intergenic
967310370 3:188100394-188100416 GGCTGGTCTCCGACTCCTGGTGG - Intergenic
968591560 4:1462267-1462289 GGCTGCTCTCCGACTCCAAGTGG + Intergenic
968756086 4:2417355-2417377 GGCCCTGCTCCGGCTGCAGCGGG + Intronic
968898400 4:3418592-3418614 GGCTGCTCCCCGCCTGCAGGGGG + Intronic
971930360 4:33073853-33073875 GGCATTTATCCGACTGCATCAGG + Intergenic
973993471 4:56435005-56435027 GGCTCCTCCCCGACTGCAGGCGG - Intronic
977045522 4:92064504-92064526 GGCTGTTCTTGGTCTACAGCTGG - Intergenic
980480385 4:133379879-133379901 GGCTCTTCTCCGACCGCCCCTGG - Intergenic
985714753 5:1449244-1449266 TGTTGTTCTCCGACTTTAGCTGG + Intergenic
990380752 5:55220528-55220550 GGCTGCGCACAGACTGCAGCCGG - Exonic
990741373 5:58915935-58915957 GGCGGGTCTGCGACTGCGGCCGG - Intergenic
994886114 5:105564052-105564074 GGCTCTTCTCTGACTGCCCCGGG - Intergenic
997688988 5:135812934-135812956 GCCTCTTCTCCACCTGCAGCTGG - Intergenic
999225535 5:150020347-150020369 GGCAGTTCTCTAACTGCAGTGGG + Intronic
1001951497 5:175819850-175819872 GGATGTTCTCAGCCTGAAGCAGG + Intronic
1002604980 5:180377620-180377642 GGCTCCTCTCCGACCCCAGCAGG - Intergenic
1006738837 6:36293208-36293230 GGGTGGTCTCAGAATGCAGCGGG + Intronic
1014867579 6:126550930-126550952 GGCTCTTCTCCGACTGCCTTTGG + Intergenic
1019920093 7:4157856-4157878 GGCGGGTCTCTGCCTGCAGCCGG + Intronic
1022728835 7:33004268-33004290 GGCTGTTCTCACACAGAAGCTGG + Intronic
1024904694 7:54363091-54363113 GGCTGTTGTCCGACACCAGATGG + Intergenic
1026108454 7:67439235-67439257 GGCTGTGCTCTGAATCCAGCAGG - Intergenic
1026494820 7:70893124-70893146 GGCTCTTCTCTGCCTGCTGCAGG + Intergenic
1031379164 7:121063460-121063482 CTCTCTTCTCCAACTGCAGCTGG + Intronic
1032282479 7:130515563-130515585 AGTGGTTCTCCAACTGCAGCTGG - Intronic
1035252052 7:157604037-157604059 GGCTGTTCTCCGCCTTCAGCAGG + Exonic
1039461442 8:37748829-37748851 TGCTGTTCTGAGATTGCAGCTGG + Intronic
1040103398 8:43524688-43524710 GGCTGCTCTCAGACTGGGGCTGG - Intergenic
1041015193 8:53586052-53586074 GGCTGTTCCCCTAGTGCTGCAGG - Intergenic
1042941186 8:74109976-74109998 AGCAGTTCTCTGACTGCAGTTGG + Intergenic
1042969534 8:74392866-74392888 GGGTGTTCTTCATCTGCAGCAGG - Intronic
1048281225 8:133106814-133106836 GGCTGTTCTCTGCCTGCATGGGG - Intronic
1050489532 9:6173280-6173302 GGTAGTTCTTCGACTGCAGCAGG - Intergenic
1057039663 9:91838699-91838721 TCCTATTTTCCGACTGCAGCGGG - Intronic
1057310571 9:93940558-93940580 GGCTGTTCTCCTAGGGAAGCTGG - Intergenic
1062474239 9:136719564-136719586 GCCTGTTCCCCGCCTGCAGCAGG - Intronic
1062596225 9:137301106-137301128 GGCTGCTCCTCGGCTGCAGCCGG + Exonic
1062618268 9:137407725-137407747 GGCACTTCTCCCACTCCAGCTGG - Intronic
1188895183 X:35658915-35658937 GGTAGTTCTTCAACTGCAGCAGG + Intergenic
1191884931 X:65878626-65878648 GTCAGTTCTCCCACTGCAGCAGG - Intergenic
1196271404 X:113716274-113716296 GACTGTCCTCCGACTGCCCCCGG - Intergenic
1202039132 Y:20664555-20664577 GGCTGGTCTCCCACTTCTGCAGG + Intergenic