ID: 1096156577

View in Genome Browser
Species Human (GRCh38)
Location 12:49344823-49344845
Sequence CTGGAGTAGGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2222
Summary {0: 1, 1: 0, 2: 17, 3: 223, 4: 1981}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096156565_1096156577 4 Left 1096156565 12:49344796-49344818 CCAGCCCAGCAGAATACCCCACG 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG 0: 1
1: 0
2: 17
3: 223
4: 1981
1096156568_1096156577 -1 Left 1096156568 12:49344801-49344823 CCAGCAGAATACCCCACGGACAC 0: 1
1: 0
2: 1
3: 2
4: 76
Right 1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG 0: 1
1: 0
2: 17
3: 223
4: 1981
1096156567_1096156577 0 Left 1096156567 12:49344800-49344822 CCCAGCAGAATACCCCACGGACA 0: 1
1: 0
2: 1
3: 8
4: 62
Right 1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG 0: 1
1: 0
2: 17
3: 223
4: 1981

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096156577 Original CRISPR CTGGAGTAGGAGAAGGAGGA GGG Intergenic
Too many off-targets to display for this crispr