ID: 1096156833

View in Genome Browser
Species Human (GRCh38)
Location 12:49345737-49345759
Sequence TACCCGGGTCTCCCCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096156833_1096156841 -1 Left 1096156833 12:49345737-49345759 CCCCCGCCGGGGAGACCCGGGTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1096156841 12:49345759-49345781 AGTAAAGAACAAGACAGAATGGG 0: 1
1: 0
2: 3
3: 72
4: 594
1096156833_1096156842 4 Left 1096156833 12:49345737-49345759 CCCCCGCCGGGGAGACCCGGGTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1096156842 12:49345764-49345786 AGAACAAGACAGAATGGGACAGG 0: 1
1: 0
2: 3
3: 53
4: 564
1096156833_1096156845 17 Left 1096156833 12:49345737-49345759 CCCCCGCCGGGGAGACCCGGGTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1096156845 12:49345777-49345799 ATGGGACAGGCAGGACGGTTTGG 0: 1
1: 0
2: 0
3: 15
4: 149
1096156833_1096156843 8 Left 1096156833 12:49345737-49345759 CCCCCGCCGGGGAGACCCGGGTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1096156843 12:49345768-49345790 CAAGACAGAATGGGACAGGCAGG 0: 1
1: 0
2: 3
3: 32
4: 307
1096156833_1096156844 12 Left 1096156833 12:49345737-49345759 CCCCCGCCGGGGAGACCCGGGTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1096156844 12:49345772-49345794 ACAGAATGGGACAGGCAGGACGG 0: 2
1: 1
2: 4
3: 58
4: 674
1096156833_1096156840 -2 Left 1096156833 12:49345737-49345759 CCCCCGCCGGGGAGACCCGGGTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1096156840 12:49345758-49345780 TAGTAAAGAACAAGACAGAATGG 0: 1
1: 0
2: 4
3: 51
4: 588

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096156833 Original CRISPR TACCCGGGTCTCCCCGGCGG GGG (reversed) Intergenic
901800691 1:11706426-11706448 TGCCCGGGCCCCGCCGGCGGTGG - Exonic
903354991 1:22741053-22741075 TCCCCAGGTCTCCCCTGTGGTGG + Intronic
903867774 1:26411302-26411324 TACTCGGGTCTCCCTGCCTGGGG + Intronic
904773570 1:32893971-32893993 TCCCCGGGTCTGCCCTGTGGGGG + Exonic
906292990 1:44632011-44632033 TCCCCGTGGCTGCCCGGCGGCGG - Intronic
922705637 1:227788719-227788741 GGCCCGGGACTCCGCGGCGGGGG - Intergenic
923207937 1:231776590-231776612 TGCCCAGGGCTCCCTGGCGGGGG + Intronic
1065192305 10:23224240-23224262 TACCCGGGTATCAGCAGCGGAGG - Intronic
1065364664 10:24923486-24923508 TACCTGGGTATCACCAGCGGAGG - Intronic
1065637554 10:27746029-27746051 GGCCCGGGGCTCCCCGGCAGCGG - Exonic
1069199224 10:65592379-65592401 TGCCTGGGTCTCACCAGCGGAGG + Intergenic
1070343578 10:75520994-75521016 TACCTGGGTATCACCAGCGGAGG + Intronic
1075724608 10:124604928-124604950 TGCCCGGGACTCCCAGTCGGTGG - Intronic
1084265625 11:68003883-68003905 GGCCAGGGTCCCCCCGGCGGGGG - Intronic
1088152075 11:106757659-106757681 TACCCGGGTATCACCAGCGGAGG + Intronic
1090265731 11:125351716-125351738 TACCTGGGTCTCCCCCACTGTGG - Intronic
1096156833 12:49345737-49345759 TACCCGGGTCTCCCCGGCGGGGG - Intergenic
1097083299 12:56449104-56449126 TTCCCGGGTCTCACCGGACGCGG - Intronic
1097679135 12:62632589-62632611 TACCCGGGGCTCCCCCGGGCAGG - Intergenic
1098638432 12:72812851-72812873 TGCCTGGGTATCCCCAGCGGAGG + Intergenic
1101466927 12:104958372-104958394 GGCCCGGGCTTCCCCGGCGGCGG - Intronic
1106608164 13:31251046-31251068 TGCCTGGGTATCCCCGGTGGAGG - Intronic
1113383759 13:109828661-109828683 TACCTGGGTATCACCAGCGGAGG + Intergenic
1113695522 13:112343036-112343058 TCCCCGCGTCTCCCCCGCGCAGG - Intergenic
1116792806 14:49357406-49357428 TACCTGGGTATCACCAGCGGAGG - Intergenic
1117204243 14:53424592-53424614 TGCCTGGGTATCACCGGCGGAGG - Intergenic
1117930451 14:60836546-60836568 TGCCTGGGTATCCCCAGCGGAGG + Intronic
1119432797 14:74579260-74579282 TGCCTGGGTCTCCCCGGCAGTGG + Intronic
1124617177 15:31250149-31250171 CACCCGGGGTTCCCAGGCGGAGG - Intergenic
1125674253 15:41494073-41494095 GGCCCGGGGCTCCCCCGCGGCGG - Exonic
1132398029 15:101488949-101488971 CACCCGGCTCTCCCCCGCGGGGG - Intronic
1141694507 16:85613291-85613313 CACCCGGGGCTGCTCGGCGGCGG - Exonic
1144434036 17:15223416-15223438 TGCCTGGGTCTCACCAGCGGAGG + Intergenic
1150884702 17:69071424-69071446 TGCCTGGGTCTCACTGGCGGAGG - Intergenic
1155932794 18:31724459-31724481 CTCCCGGGTCTGCCCGGGGGTGG - Intergenic
1160466560 18:79082713-79082735 TACCTGGGTTTCACCAGCGGAGG + Intronic
1162398733 19:10432255-10432277 TTCCCGGGTCTGCACGGGGGAGG - Intronic
1162691984 19:12440780-12440802 GACCCGGGTCCCCCTGGCGTAGG - Intronic
1168332467 19:55578488-55578510 GAAGCGGGGCTCCCCGGCGGGGG + Exonic
1168530758 19:57127063-57127085 CACCTGGGTATCCCCAGCGGAGG + Intronic
928893463 2:36234432-36234454 TCCCCGGGTCTCGCCCTCGGTGG + Intergenic
940883434 2:158968933-158968955 CTCCCGGGTGTGCCCGGCGGAGG - Intronic
943929903 2:193836148-193836170 TGCCCGGGTTTCACCAGCGGAGG + Intergenic
945210791 2:207380497-207380519 TGCCTGGGTATCCCCAGCGGAGG + Intergenic
948407839 2:237735950-237735972 TAACCGGTGCTCCCTGGCGGTGG + Intronic
1172661695 20:36573331-36573353 GAGCGGGCTCTCCCCGGCGGAGG + Intergenic
1173543783 20:43876416-43876438 TGCCTGGGTATCACCGGCGGAGG + Intergenic
1177136463 21:17309451-17309473 TGCCCGGGTATCACCAGCGGAGG - Intergenic
1177271748 21:18857747-18857769 TACACGGTTTTCCTCGGCGGCGG - Intergenic
1180181977 21:46122098-46122120 TGCCGGGGTCTCCCTGGAGGAGG - Exonic
1183966622 22:41446376-41446398 CACTCGGGTCTCCGCGGCGGCGG + Exonic
950088495 3:10278371-10278393 TTCCCGGGCCTCCCAGGCAGAGG - Exonic
953337359 3:42104556-42104578 TGCCCGGGTATCACCAGCGGAGG - Intronic
959842963 3:110999436-110999458 TACCTGGGTATCACCAGCGGAGG - Intergenic
969930472 4:10626092-10626114 AACCCAGGTCTCCCTGGCTGGGG + Intronic
972437076 4:39044858-39044880 TCCCCGGGTGGCCCCGGAGGGGG - Intergenic
983543390 4:168936113-168936135 TACCTGGGTATCACCAGCGGAGG - Intronic
986345048 5:6826994-6827016 TACCAGGGTGCCCCCGGCTGAGG + Intergenic
992597437 5:78360563-78360585 CACCCGGATCTGCTCGGCGGCGG + Exonic
998149008 5:139746554-139746576 TTCTCGGGCCTCCCCCGCGGGGG - Intergenic
998963001 5:147509058-147509080 AACCCGGGTCACCACGGCAGAGG - Intronic
1011387587 6:86814942-86814964 TTGCCGGGTATCACCGGCGGAGG + Intergenic
1015525870 6:134175199-134175221 AACCCGGCTTTCTCCGGCGGCGG - Intronic
1016985809 6:149895066-149895088 TACCTGGGTATCACCAGCGGAGG + Intronic
1019536357 7:1531449-1531471 TAACCGGGTCTCCCCACAGGCGG + Intronic
1023945058 7:44796693-44796715 TACACGGTTTTCCTCGGCGGTGG - Exonic
1030086334 7:105819039-105819061 CACCGGGGTCTCTCCGGGGGTGG - Intronic
1031612472 7:123844304-123844326 TACCTGGGTATCACCAGCGGAGG + Intronic
1035022640 7:155808479-155808501 GACCCGGGTCTCCCTGCCCGGGG - Intronic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1038963479 8:32548006-32548028 TTCCCGGGTCTCCGGGGCGCTGG + Intronic
1050513059 9:6414020-6414042 TCTCCGGGTCTCCCGCGCGGTGG - Intronic
1051175258 9:14353699-14353721 TCCCCGGGTCTCACCGCCTGCGG - Intronic
1062414829 9:136443022-136443044 CACCCGGGTCTCCCCGGAGTGGG - Intronic
1185610859 X:1392886-1392908 TGCCCGTGTCTGCCCGGCGGGGG + Intergenic
1190265723 X:48826463-48826485 TCCCCGGGGCACCCCGGCGGCGG - Intergenic
1200746842 Y:6910806-6910828 TTTCCGGGACTCCGCGGCGGCGG + Exonic