ID: 1096156841

View in Genome Browser
Species Human (GRCh38)
Location 12:49345759-49345781
Sequence AGTAAAGAACAAGACAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 594}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096156828_1096156841 7 Left 1096156828 12:49345729-49345751 CCACCCATCCCCCGCCGGGGAGA 0: 1
1: 0
2: 1
3: 16
4: 199
Right 1096156841 12:49345759-49345781 AGTAAAGAACAAGACAGAATGGG 0: 1
1: 0
2: 3
3: 72
4: 594
1096156833_1096156841 -1 Left 1096156833 12:49345737-49345759 CCCCCGCCGGGGAGACCCGGGTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1096156841 12:49345759-49345781 AGTAAAGAACAAGACAGAATGGG 0: 1
1: 0
2: 3
3: 72
4: 594
1096156829_1096156841 4 Left 1096156829 12:49345732-49345754 CCCATCCCCCGCCGGGGAGACCC 0: 1
1: 0
2: 1
3: 6
4: 111
Right 1096156841 12:49345759-49345781 AGTAAAGAACAAGACAGAATGGG 0: 1
1: 0
2: 3
3: 72
4: 594
1096156834_1096156841 -2 Left 1096156834 12:49345738-49345760 CCCCGCCGGGGAGACCCGGGTAG 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1096156841 12:49345759-49345781 AGTAAAGAACAAGACAGAATGGG 0: 1
1: 0
2: 3
3: 72
4: 594
1096156837_1096156841 -7 Left 1096156837 12:49345743-49345765 CCGGGGAGACCCGGGTAGTAAAG 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1096156841 12:49345759-49345781 AGTAAAGAACAAGACAGAATGGG 0: 1
1: 0
2: 3
3: 72
4: 594
1096156835_1096156841 -3 Left 1096156835 12:49345739-49345761 CCCGCCGGGGAGACCCGGGTAGT 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1096156841 12:49345759-49345781 AGTAAAGAACAAGACAGAATGGG 0: 1
1: 0
2: 3
3: 72
4: 594
1096156836_1096156841 -4 Left 1096156836 12:49345740-49345762 CCGCCGGGGAGACCCGGGTAGTA 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1096156841 12:49345759-49345781 AGTAAAGAACAAGACAGAATGGG 0: 1
1: 0
2: 3
3: 72
4: 594
1096156824_1096156841 25 Left 1096156824 12:49345711-49345733 CCGCTGGGCTGGGATAGACCACC 0: 1
1: 0
2: 0
3: 20
4: 127
Right 1096156841 12:49345759-49345781 AGTAAAGAACAAGACAGAATGGG 0: 1
1: 0
2: 3
3: 72
4: 594
1096156830_1096156841 3 Left 1096156830 12:49345733-49345755 CCATCCCCCGCCGGGGAGACCCG 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1096156841 12:49345759-49345781 AGTAAAGAACAAGACAGAATGGG 0: 1
1: 0
2: 3
3: 72
4: 594

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096156841 Original CRISPR AGTAAAGAACAAGACAGAAT GGG Intergenic
902259035 1:15210139-15210161 AGAAAAGAACAAGGCAGGAGAGG - Intronic
902587364 1:17448521-17448543 AGAAAAGAAAAAGAAAGAATGGG - Intergenic
903547357 1:24134410-24134432 AGAAAAGAAAAAGTCAGAATCGG + Intronic
903974192 1:27138465-27138487 AGCCAGGAACAAGACAGAAGAGG - Intronic
904322084 1:29704318-29704340 AGAAAAGAAGAAAAGAGAATGGG + Intergenic
905345338 1:37307357-37307379 AGGAAAGAACAAGGTAGAAGGGG + Intergenic
905476735 1:38234009-38234031 AGGAAAGAAAGAGACAGATTGGG - Intergenic
905539589 1:38749252-38749274 AGGGAAGAACAAGACAGACATGG - Intergenic
906013251 1:42549616-42549638 AGTCAAGAACAAGAGAGTCTGGG - Intronic
906296855 1:44654149-44654171 AGTAAAGAAAAAAAGAGAGTAGG + Exonic
906681318 1:47727567-47727589 AGTTAGGTACAAGACAGAATGGG + Intergenic
907348504 1:53804779-53804801 AGTAAAGAAAAAAAAAAAATAGG - Intronic
907353515 1:53853162-53853184 AGTGATGAACAAGACAGACATGG + Intronic
907644838 1:56231961-56231983 AGGAAAGACCAAGACAAAGTGGG + Intergenic
908034096 1:60033314-60033336 AGTGAAAAACAAGGCAGAAAAGG - Intronic
908407964 1:63833393-63833415 AGAAAAGAGCAAGCCAGAAAAGG + Intronic
909011216 1:70337689-70337711 ACAAAAAAACAAGACAGATTTGG + Intronic
909147840 1:71959885-71959907 AATAAATAAGAAGACAGAAACGG + Intronic
909154062 1:72048419-72048441 TTTAAAGAACAAGATAGAAAAGG - Intronic
909462095 1:75928565-75928587 AGTAAAGAACAACAGATAATAGG + Intronic
909863817 1:80639917-80639939 AGTAAAGAAGAGGACATAAAAGG + Intergenic
909944676 1:81650157-81650179 AGTGAAGAACAAGACAGAAAGGG - Intronic
910010402 1:82453985-82454007 AGGAAAAAGGAAGACAGAATGGG + Intergenic
910227855 1:84954796-84954818 AGCAATGAACAAGACAGACATGG + Intronic
910422150 1:87077658-87077680 AGTAGTGAACAAGACAGACAAGG - Intronic
910710779 1:90177771-90177793 AGTGAAGAAAAAGAAAGAAAAGG + Intergenic
910894092 1:92049491-92049513 AGCAGTGAACAAGACAGAAAAGG - Intronic
910955280 1:92696668-92696690 TTTAAAGAAAAAGCCAGAATAGG - Intronic
911740315 1:101379843-101379865 AGTAGAGAACCAGTCAGAGTAGG - Intergenic
911741551 1:101391675-101391697 AGAAAAGAAAAAGAAAAAATTGG - Intergenic
912063653 1:105706999-105707021 AGTAAAAAACAGGACAGAAAGGG + Intergenic
912068344 1:105776575-105776597 AGAAAAGAAAAAGACAGAAAAGG - Intergenic
912549373 1:110474915-110474937 AGTCCAGAAAAATACAGAATTGG - Intergenic
912552460 1:110492970-110492992 TGCCAAGAACGAGACAGAATTGG + Intergenic
912684899 1:111754804-111754826 AGAGGAGAACAAGACAGAATAGG + Intronic
912864553 1:113245712-113245734 ATTAAGGAACAGGACAGAAAGGG + Intergenic
913481926 1:119296874-119296896 AGTATAGGACAGGACAGAATAGG - Intergenic
913481955 1:119297044-119297066 AGGACAGGACAAGACAGGATAGG - Intergenic
914249336 1:145908646-145908668 AGTACAGAGCAAGACATAGTTGG - Intronic
914796472 1:150924409-150924431 AGAAAAGAAAAAGAAAGAAAGGG + Intergenic
915706114 1:157845437-157845459 AGAAAAAAAAAAGATAGAATAGG + Intronic
915893991 1:159797021-159797043 AGCAAAGAGCAAGACAGAAAAGG + Intergenic
916570885 1:166026574-166026596 GGTAAAGGACAATACAGATTGGG + Intergenic
916836514 1:168551277-168551299 AGAAAAGAACTAGAGAGAATGGG - Intergenic
916987320 1:170205831-170205853 AAGAAAGGACAAAACAGAATAGG - Intergenic
917051066 1:170924191-170924213 AGAAAAGAACAACACACACTTGG + Intergenic
917267783 1:173240037-173240059 AGAAAAGAAAAAAAGAGAATGGG + Intergenic
917768638 1:178251098-178251120 AGTCAGGAACAAAACAGAAATGG - Intronic
918112065 1:181464698-181464720 AGTAAAGAAAAAGAAAGAAAAGG - Intronic
918139310 1:181707171-181707193 ATGAAAGAACAAAACAGAAAAGG + Intronic
918384080 1:183987313-183987335 AATAAAGAACTTAACAGAATTGG - Intronic
918403236 1:184185410-184185432 AGAACAGAACAGAACAGAATAGG + Intergenic
919299359 1:195740826-195740848 AATAAAGAACATGAAACAATTGG + Intergenic
920780135 1:208982225-208982247 AGTAAAGAACAAGAACTAAGAGG - Intergenic
920803578 1:209211432-209211454 AGAAAAGAAGAGGAAAGAATAGG + Intergenic
921139432 1:212292228-212292250 AGAAAAGACAAAGACAAAATAGG - Intronic
921267369 1:213433455-213433477 ATTAAAGAACAATTTAGAATAGG - Intergenic
921338761 1:214113349-214113371 AGGAAAGAACAAGAGAAACTGGG - Intergenic
921355706 1:214282247-214282269 AGTGAAAGACAAGACTGAATTGG - Intronic
921599569 1:217091959-217091981 TGAAAAGAACAAAACAAAATTGG - Intronic
921958666 1:221011328-221011350 AGAAAAGCACAAGGAAGAATGGG - Intergenic
922020380 1:221698478-221698500 AGTAGAGAAGAACAAAGAATTGG - Intergenic
922203567 1:223427442-223427464 AGTAACGAACAAAACAGACAAGG + Intergenic
922701024 1:227760746-227760768 AGGAAAGAAGAAAACAGAACAGG - Intronic
922970399 1:229731461-229731483 AGTTAACAACAAGACAGAATGGG + Intergenic
923578769 1:235187011-235187033 AGAAAAGAACAAGAAAGACTTGG - Intronic
923933071 1:238725358-238725380 AGTAAAGAAGAAAAAATAATAGG - Intergenic
923972008 1:239214335-239214357 AGTAAAGTACAAGATAAGATAGG - Intergenic
923984065 1:239359936-239359958 AACAAAGAACAAAACAGGATTGG + Intergenic
924370224 1:243339987-243340009 GGAAAAGAACAAAACATAATTGG + Intronic
1062782196 10:223420-223442 AGAGAAGAACAGAACAGAATAGG - Intronic
1063931992 10:11037873-11037895 GGTAGAGAGCAAGATAGAATTGG + Intronic
1064384967 10:14882390-14882412 ACTAAAGAACTTGAAAGAATGGG - Intronic
1064603070 10:17012833-17012855 ATTAAGGAAAAAGACACAATGGG - Intronic
1068012438 10:51470154-51470176 TGTAAAGAATAAGACAGCATTGG - Intronic
1068067095 10:52144974-52144996 AGAATAGAACAAGACAGAGCAGG + Intronic
1068105917 10:52616090-52616112 TGAAAACAAGAAGACAGAATTGG + Intergenic
1069099511 10:64301703-64301725 GGTGAAGAACAAGAAAGGATGGG - Intergenic
1069246610 10:66215110-66215132 AGTAAGGAACAAGAAATAACAGG + Intronic
1070214753 10:74365384-74365406 AGTAAAAGACCAGACAGAAAAGG - Intronic
1070242874 10:74700633-74700655 AGAAAAGAAAAAGAAAGAAAAGG + Intronic
1071712553 10:88063850-88063872 AGTAAAGAACATTTCAGATTTGG + Intergenic
1071929010 10:90444618-90444640 AGTAGGAAACAAGAGAGAATGGG - Intergenic
1071967661 10:90868639-90868661 AGAAAAAGACAAGACAGAATAGG - Intergenic
1072114087 10:92352163-92352185 AGTGGTGAACAAGACAGACTTGG + Exonic
1072157931 10:92740797-92740819 AGGAGAGGACAAGACAGAAGAGG - Intergenic
1072334205 10:94383177-94383199 AGCAAAGAGAAAGAAAGAATAGG - Intergenic
1072561114 10:96575182-96575204 AGGAACCAACAAGAGAGAATAGG - Intronic
1072718004 10:97764467-97764489 AATAAAGAACAGGACAGACAGGG - Intergenic
1073571896 10:104587642-104587664 AGCAGTGAACAAAACAGAATTGG + Intergenic
1074237983 10:111605422-111605444 GGTAAAGAACAAGAAAGAGTAGG + Intergenic
1074551515 10:114447210-114447232 AGTAAAGACACAGACATAATTGG + Intronic
1074613286 10:115041202-115041224 ATTAAGGAAAAAGACACAATGGG + Intergenic
1074843987 10:117380538-117380560 AGTAAGCAATCAGACAGAATTGG - Intergenic
1077907212 11:6543986-6544008 GGGAAAGAAAAAGACAGAAAGGG + Intronic
1078260807 11:9706398-9706420 AATAAACAAAAAGACAAAATGGG - Intronic
1078654480 11:13225705-13225727 AGTAAAGAAAAAGAAAGCTTTGG + Intergenic
1078664400 11:13312703-13312725 AGTGAAAAACAAGACAAAATAGG - Intronic
1078666366 11:13329067-13329089 AGTCAAGAGCAAGACAGAGAGGG + Intronic
1079259129 11:18860963-18860985 AATAAGGAACAAGAGAGAACTGG + Intergenic
1079711945 11:23695408-23695430 ATTAAATAACAAAACAGGATGGG + Intergenic
1079815276 11:25048705-25048727 AGGAAAGAAAAAGAGAGTATGGG + Intronic
1080219995 11:29891330-29891352 AACAAATAACAAGACAGAATTGG + Intergenic
1080452781 11:32392484-32392506 AATAAAGAAAAAGAAAGAAAAGG - Intronic
1084074686 11:66764040-66764062 AGTAGTGAACAAGACAGATTTGG + Intronic
1084739371 11:71129081-71129103 TGCAAAGAAAAAGACAGAAATGG - Intronic
1085329898 11:75639637-75639659 TGTAAAGAAGAATCCAGAATTGG + Intronic
1085690163 11:78657884-78657906 AGAAAAGAAAAACACAGATTTGG - Exonic
1085728311 11:78974680-78974702 AGAAAAGAAAAAGAAAGAAAGGG - Intronic
1086153069 11:83634306-83634328 AATAAAGATAAAGAAAGAATCGG + Intronic
1087306761 11:96498718-96498740 AGTGGAGAACAAGACAGAGAGGG - Intronic
1087500690 11:98949560-98949582 ATTAAATAAAAAGACAGAAAAGG - Intergenic
1087601755 11:100326025-100326047 TTTAAAGAACAATTCAGAATAGG + Intronic
1088080077 11:105901372-105901394 TATAGATAACAAGACAGAATTGG - Intronic
1088181873 11:107121805-107121827 AGAAAAGAAGAAGAAAGAATGGG + Intergenic
1088706290 11:112467223-112467245 AGGACAGAAAAAGACAGAAGAGG - Intergenic
1089000883 11:115051262-115051284 AGAAAAGATGAAGACAAAATTGG + Intergenic
1089539995 11:119184013-119184035 AGTAAAGAAGAGGCCACAATTGG - Exonic
1089851949 11:121505999-121506021 AATATAGAACAAGGCAGAAAAGG - Intronic
1090225390 11:125068919-125068941 AGAAGTGAAGAAGACAGAATAGG + Intronic
1090385053 11:126353178-126353200 AGGAAAGAAAAAGAAAGAAGAGG + Intergenic
1090707989 11:129357246-129357268 AGAAAAGAAAAAGAAAGAAGAGG - Intergenic
1090742970 11:129682941-129682963 GGTACAGAATAAGACAAAATGGG - Intergenic
1092038138 12:5359156-5359178 AAAAAAAAAAAAGACAGAATAGG + Intergenic
1093387126 12:18570549-18570571 AGTAGAGAACAAGAGAGAGAGGG + Intronic
1094456777 12:30643960-30643982 AGTAAAGCACAAGACATGAGTGG - Intronic
1095922456 12:47544505-47544527 AAGACAGAACCAGACAGAATGGG - Intergenic
1096156841 12:49345759-49345781 AGTAAAGAACAAGACAGAATGGG + Intergenic
1097082198 12:56440556-56440578 AGTTTAGTACCAGACAGAATTGG - Intronic
1097326950 12:58288083-58288105 AGTAGAGAAGGAGAAAGAATAGG + Intergenic
1097351489 12:58553937-58553959 AGGACAGAACAAGAAAGAAATGG + Intronic
1097519895 12:60654258-60654280 AGTAAAGAAAATGACAGATATGG - Intergenic
1097533211 12:60832285-60832307 AGAAAAGAAAAAGACAGAGGAGG - Intergenic
1097812103 12:64030179-64030201 AATAAAGAAGAAAACATAATTGG + Intronic
1098162218 12:67656651-67656673 AGTAGTGAACAAGACAGACATGG + Intronic
1098215808 12:68216570-68216592 ATAAAAGAATAAGACAGGATTGG + Intronic
1098719757 12:73881774-73881796 AGGAAAAAAAAACACAGAATGGG - Intergenic
1099347466 12:81520637-81520659 AGTACATAACAAGACAGACAAGG + Intronic
1099389139 12:82057400-82057422 AGTAATGAACAATACAGACCTGG + Intergenic
1099927143 12:89032203-89032225 TGTAGAGAACAAGAAAGAATTGG + Intergenic
1099964381 12:89429960-89429982 AGCAAAGAACAAGTCAGACATGG + Intronic
1100785313 12:98072197-98072219 AGGGAAGAACAACACACAATGGG + Intergenic
1104319064 12:127733109-127733131 AATAAAAAAAAAAACAGAATTGG - Intergenic
1104913946 12:132254662-132254684 GGTAAAGTACAAGAGAGAAGAGG + Intronic
1105787481 13:23763770-23763792 ATTAAAGAGCAAGACACAACGGG - Intronic
1106725221 13:32477377-32477399 ATTAATGAACAAGAAAGCATTGG - Intronic
1107910495 13:45101081-45101103 AGTAAAGATCCAGACTGAAAGGG - Intergenic
1108022211 13:46139193-46139215 AGTAAACTAAAAGACAGAGTTGG + Intronic
1108110455 13:47065794-47065816 AGGCAAGACAAAGACAGAATAGG + Intergenic
1108256314 13:48614645-48614667 AGTAAAAAACAAAACAAAATGGG - Intergenic
1109009253 13:56918865-56918887 AGAAAAGAAATAGACAGGATAGG + Intergenic
1109311113 13:60694825-60694847 AGGAAAGAAAAGGAAAGAATAGG + Intergenic
1109440406 13:62363991-62364013 AGAAAAGAAAAAGAGAGAATGGG - Intergenic
1109550630 13:63894334-63894356 AGTAAATAAAAAGTGAGAATAGG - Intergenic
1110199896 13:72836985-72837007 AGAGAAGAACAAGAAAAAATAGG - Intronic
1110677755 13:78270139-78270161 AGGAAAGAAAAAGACATAAAAGG - Intergenic
1111052237 13:82899940-82899962 AGAACAGAACAGAACAGAATAGG + Intergenic
1111128835 13:83948059-83948081 AGTGAAGAAAAAGACAGATGTGG - Intergenic
1111205672 13:85006832-85006854 TGTAAAGCACAATAAAGAATAGG + Intergenic
1111304642 13:86391917-86391939 AAGAAAGAACTAGATAGAATTGG - Intergenic
1111373980 13:87354263-87354285 AGTAAGGGACAAAACAGAATAGG - Intergenic
1111851279 13:93578359-93578381 AATAAATAACAAGACTGAAAGGG - Intronic
1112187875 13:97145341-97145363 AGAAAAGAGAAAGAAAGAATTGG + Intergenic
1112655082 13:101443853-101443875 AGCAAAGAACAAGAGAGAAATGG + Intergenic
1112836332 13:103518803-103518825 GATAAAGAAAAAGACACAATGGG - Intergenic
1113352365 13:109541928-109541950 AGCAAAGCACAAAACAGAAGGGG + Intergenic
1113829547 13:113284589-113284611 AATAATGAAAAACACAGAATGGG - Intergenic
1114172427 14:20286449-20286471 AAAAAAGAAAAAGACAGACTGGG + Exonic
1115979834 14:39038351-39038373 AGTAAATTACAAGGCAGAATGGG - Intronic
1115995420 14:39190538-39190560 AGAAAAGAAAAACACAAAATAGG - Intergenic
1116491251 14:45506084-45506106 AATGAAGAACAACAGAGAATTGG - Intergenic
1116853767 14:49933764-49933786 AGCAAACAAAAAGACAGAAAGGG - Intergenic
1117449253 14:55835073-55835095 GGGAAAGACCAAGACAGGATTGG - Intergenic
1117873738 14:60227868-60227890 AGTCAAGAACAAGACAGATATGG - Intergenic
1118550752 14:66947134-66947156 AATAAAGCACAAGAGAGAAATGG - Intronic
1119337155 14:73843539-73843561 AGAAAAGAAAAAGAAAGAAAGGG - Intergenic
1119404826 14:74391392-74391414 ATTAAAGAATAAAACAAAATAGG - Intergenic
1120407356 14:84105616-84105638 AGGAAAGAGAAAGACAGAAGGGG + Intergenic
1120988263 14:90353264-90353286 AGAAAAGAAAAAGAAAAAATTGG - Intergenic
1121132422 14:91460434-91460456 AGAAAAAAAAAAGACTGAATGGG + Intronic
1121304774 14:92899201-92899223 AGTAAGAAACAAGACAGACAAGG + Intergenic
1121695730 14:95910344-95910366 TGTAAAAAACAAAATAGAATGGG + Intergenic
1121981080 14:98454514-98454536 TGTAAGGCACAAGAGAGAATTGG + Intergenic
1122008403 14:98725594-98725616 AGTAAAGAGGAAAACAAAATAGG + Intergenic
1122936613 14:104961184-104961206 AGTAAAGCATATGACAGGATGGG + Intronic
1123835920 15:24193227-24193249 AGGAAAGAAAAAGAAAGAAAAGG + Intergenic
1124430773 15:29606208-29606230 AGAAAAGAAAAAGACAGACATGG - Intergenic
1124923121 15:34045860-34045882 AGCAGAGAACAAGAAACAATCGG + Intronic
1125052545 15:35317374-35317396 AGGAAAGAAAAAGAAAGAAAAGG + Intronic
1125169029 15:36744520-36744542 AGAAATGAACAAGACAGATGTGG + Intronic
1125527520 15:40387046-40387068 AGGAAAGAACCAGACATAAAAGG - Intronic
1126768223 15:52030313-52030335 AGTAGAGAATAAGACAGACAAGG - Intronic
1126909903 15:53406918-53406940 GGGAAAGAGGAAGACAGAATTGG - Intergenic
1127027739 15:54826121-54826143 AATAAAAAACAAGAAAGAGTTGG - Intergenic
1127411586 15:58712828-58712850 AAAAAAGAACAAGACAGGAACGG + Intronic
1127857551 15:62965078-62965100 TGTAGAGAAGTAGACAGAATTGG - Intergenic
1128028230 15:64457623-64457645 AGCCAAGATCAAGACAGCATGGG + Intergenic
1128139809 15:65291240-65291262 ATTAAAGAAGAAGAGAAAATAGG - Intronic
1129312017 15:74719459-74719481 AGTAAAACCCAACACAGAATGGG + Intergenic
1130558489 15:84940571-84940593 AAGAAAGAAAAAGAAAGAATAGG - Intronic
1131325392 15:91438518-91438540 AGAAAAGAAAAAGAAAAAATAGG + Intergenic
1131600827 15:93847137-93847159 AGTAGGGAACAAGACACACTGGG + Intergenic
1133446338 16:5864076-5864098 AGAAAGGAACAATACACAATGGG - Intergenic
1133770029 16:8862539-8862561 TGTAAAGAAACAGACAGAAGGGG + Intronic
1134125659 16:11614277-11614299 AGAAAAGAAAAAGAAAGAAGAGG - Intronic
1134477665 16:14589896-14589918 AGAAAAGAAAAAAACAGAAGTGG + Intronic
1134846383 16:17444324-17444346 AGTAGTGAACAAGATAGAAAAGG - Intronic
1136389737 16:29956049-29956071 AGTAAAAAACAAAACAGGCTGGG + Intronic
1137088775 16:36162312-36162334 AGTAAAGAGAAAGAAAGAAAAGG + Intergenic
1137093300 16:36221542-36221564 AGTAAAGAGAAAGAAAGAAAAGG + Intergenic
1137602630 16:49766946-49766968 AGAAAAGAAAAAAAAAGAATTGG - Intronic
1137623613 16:49893452-49893474 AGAAAAGAAAAAGAGAGAAAAGG + Intergenic
1139069641 16:63364438-63364460 AGGAAAGACCAAGACACAAGGGG + Intergenic
1139736777 16:68996973-68996995 AATAAAGAACAAAAGAGATTTGG + Intronic
1140378411 16:74464098-74464120 AGTAGAGAATAAGAAAGAAAGGG - Intronic
1141112871 16:81284635-81284657 ACTAAAAAATAAAACAGAATGGG - Intronic
1143267220 17:5648095-5648117 AATAAAGAAAAACACAAAATGGG - Intergenic
1143564040 17:7710796-7710818 AGGAAAGAACAAGACAAATTAGG - Exonic
1143738249 17:8929972-8929994 AGTAAAAAACAAGAAATAATCGG + Intronic
1144505330 17:15824654-15824676 TGTAAAAAACAATACTGAATAGG - Intergenic
1145169507 17:20642529-20642551 TGTAAAAAACAATACTGAATAGG - Intergenic
1145709065 17:26952162-26952184 AGTAAAGAGAAAGAAAGAAAAGG + Intergenic
1145983623 17:29029478-29029500 AGAAAAGAAGAAGAAAGAAATGG - Intronic
1146361801 17:32182491-32182513 AACAAAAAACAAAACAGAATGGG + Intronic
1147290735 17:39440622-39440644 AGTCCATAGCAAGACAGAATGGG - Exonic
1147484634 17:40800836-40800858 AGTAGGGAATAAGGCAGAATTGG + Intergenic
1147533692 17:41303680-41303702 AGAAAAGAAGAAAACAGAAGTGG + Intergenic
1147764175 17:42822497-42822519 AGTAAAAGAGAAGACTGAATAGG - Intronic
1148581752 17:48748648-48748670 AATAAAGAAAAAGAAAAAATAGG + Intergenic
1148760789 17:49998895-49998917 AGTGATGAACAAGACAGACCAGG + Intergenic
1148974754 17:51517756-51517778 AGAAAGGAAGAAGACAAAATTGG + Intergenic
1149923349 17:60678926-60678948 ATTAAAAAACAAAACAGGATGGG + Intronic
1150357397 17:64498235-64498257 AATAAATAAAAAGAGAGAATGGG + Intergenic
1150777975 17:68097043-68097065 ATGAAAAAACAAAACAGAATAGG - Intergenic
1152055188 17:78019173-78019195 AGGAAAGAAGCAGAGAGAATGGG + Intronic
1153477839 18:5516677-5516699 AATAATTAACAAGACAGACTTGG + Intronic
1153861140 18:9208670-9208692 AGAAAAGAAGAAGACAAAAAAGG + Exonic
1154424458 18:14261308-14261330 AGAGAAGAACAAAACAGAAAAGG - Intergenic
1155001201 18:21688631-21688653 AACAAAAAACAAGACAGTATAGG + Intronic
1156647977 18:39189832-39189854 AGTTAAGAAAAATACAGAAAAGG + Intergenic
1156785832 18:40913993-40914015 AGAAAAGATGAAGACAGAAGCGG - Intergenic
1157190277 18:45575773-45575795 AAAAAAGAACAAGACAAACTAGG - Intronic
1157245101 18:46046674-46046696 AATAAAGAACACTAGAGAATGGG + Intronic
1157525679 18:48378871-48378893 AGTAAAGCAAAAGACAGAGATGG + Intronic
1157650679 18:49327079-49327101 AGTACAGAATGAGACAGAAGAGG + Intronic
1158300005 18:56041108-56041130 AGAAAAGAAGCAGACAGAAAAGG + Intergenic
1159207332 18:65270331-65270353 AGAAAAAGACAAGACATAATAGG - Intergenic
1159217695 18:65417284-65417306 AGTGCAGAAAAAGACAGTATAGG - Intergenic
1159234705 18:65656666-65656688 AGGAAAGAAGAAGACAAAAAAGG + Intergenic
1159330571 18:66989483-66989505 AGTAAAGAATAATAAAGGATTGG - Intergenic
1159495645 18:69200082-69200104 AGTAATGAACATGACAGACATGG + Intergenic
1162180230 19:8863749-8863771 AATAATGAATAAGACAGACTTGG - Intronic
1162707007 19:12562637-12562659 AGTAGAGTAAAAGACAGAAATGG + Intronic
1163004745 19:14390090-14390112 AGAAAAGAACAAGAGAGAGAGGG + Intronic
1163988868 19:20979564-20979586 AGTCAAGAACAAGAAATAAAAGG - Intergenic
1164309999 19:24037199-24037221 AGAAAAGCAAAAGACAGAAGAGG - Intronic
1164457412 19:28420417-28420439 AGAAGTGAACAAGACAGACTAGG + Intergenic
1164992545 19:32694913-32694935 ATTAAGGAAAAAGACACAATGGG - Intronic
1165112228 19:33509175-33509197 AATAAAGATCACGACAGGATGGG + Intronic
1166217135 19:41343118-41343140 AGAAAAGAAAAAGAAAAAATAGG - Intronic
1168674608 19:58268002-58268024 AGTAAAAAATAAGACAGACTGGG + Intronic
925469155 2:4140322-4140344 AGTAAAGAAAAAGTGAGAAAAGG - Intergenic
925698342 2:6606628-6606650 AGTACAGAATAACAGAGAATGGG + Intergenic
925949387 2:8896796-8896818 ATTAAGGAAAAAGACACAATGGG - Intronic
927008484 2:18877451-18877473 AGAATAGAACAACACACAATGGG - Intergenic
927349239 2:22088778-22088800 AGTAAAGAAAAAGGCAGAGATGG + Intergenic
928109022 2:28491521-28491543 AGCAAAGAACAAGACAGGCCAGG + Intronic
929103510 2:38340687-38340709 AGTAAAGAAGGAGAAATAATGGG - Intronic
929732896 2:44514647-44514669 AGCAGTGAACAAGACAGAAAAGG - Intronic
930312534 2:49759528-49759550 AGTAAAGAAAAACAGAAAATGGG + Intergenic
930971924 2:57406721-57406743 ACTAAGGAAGAAGACATAATAGG + Intergenic
931305461 2:61024096-61024118 AGCAAAGAATAAGACAGAGATGG - Intronic
931336995 2:61355801-61355823 TCAAAAGAAAAAGACAGAATTGG + Intronic
931678068 2:64717770-64717792 AAAAAAAAAGAAGACAGAATGGG + Intronic
932140157 2:69269309-69269331 ATTAAAGTACGAGACAGAATTGG + Intergenic
932992710 2:76807879-76807901 AGTAAAGAAGAAAAGAAAATAGG - Intronic
933401317 2:81800193-81800215 TCTAAAGAACAAGAAAGAATTGG + Intergenic
933575911 2:84067139-84067161 AGCAATGAACAAGAGTGAATGGG + Intergenic
933875325 2:86614664-86614686 AATAAAGAACAAGAGGCAATAGG - Intronic
935153913 2:100465378-100465400 AGCAAAGAACAAAACACCATAGG - Intergenic
935291567 2:101615254-101615276 AGTGAAGAACAAATCAGAAGGGG - Intergenic
936468426 2:112776084-112776106 TGGAAAGAAACAGACAGAATTGG - Intronic
936473279 2:112817380-112817402 AGGAAAGACCAAGGCAGGATTGG - Intergenic
936659696 2:114528975-114528997 AGTCAAGGTCAAGGCAGAATAGG - Intronic
936677579 2:114733043-114733065 AGTAAAGAAGAGGACACATTGGG + Intronic
937133504 2:119531390-119531412 AGCAAAGAGAAAGAAAGAATAGG - Intergenic
937387515 2:121449586-121449608 ATTAAAGACCAAGAAAAAATGGG + Intronic
937877892 2:126839237-126839259 AGTAACAAACAAGAAAGACTGGG + Intergenic
937947888 2:127357495-127357517 AGAATAGAACAGAACAGAATAGG + Intronic
937956412 2:127423852-127423874 AATATAGAAGAAGGCAGAATCGG - Intronic
938153435 2:128905937-128905959 AGTGAAAAACAAGACAGACAAGG - Intergenic
939285878 2:140128609-140128631 AGAAAAGAACAATAGATAATGGG - Intergenic
939582197 2:143963794-143963816 AGAAAACAACAAAACATAATGGG - Intronic
939941544 2:148357629-148357651 AGGAAAGAACAAGAAAAAAAAGG - Intronic
939971858 2:148670984-148671006 AGTCAAGAATGAGAAAGAATAGG - Intronic
940048123 2:149431817-149431839 AGTAAAAGACAACAAAGAATGGG + Intronic
940050509 2:149457826-149457848 TGTAAAGAAAATGACAGACTAGG + Intronic
940191734 2:151047714-151047736 AGTGGAGAAGAAGACAGAAAAGG - Exonic
940231174 2:151453897-151453919 AGTAGAGAAAAATACAGAAAAGG - Intronic
940431594 2:153597677-153597699 AGAAAGTAAAAAGACAGAATGGG + Intergenic
940516982 2:154695845-154695867 AGCAGAGAACAAGACAGATGAGG + Intergenic
940576555 2:155513456-155513478 AGGAAAGAAAAAGAAAGAAAAGG - Intergenic
940638591 2:156326606-156326628 GGTAGAGAAAAAGACAGAATAGG - Intronic
940644957 2:156381632-156381654 AGTAAAAAATAAGAAAGAAGAGG + Intergenic
941245689 2:163093299-163093321 ACTAAAGAAAAAGCCAGATTAGG - Intergenic
943339681 2:186664988-186665010 GGTAAGGAAAAAGCCAGAATTGG - Intronic
944400844 2:199324397-199324419 AATAAAGAATAAGAGAGACTTGG - Intronic
945478236 2:210312311-210312333 AATAAAGAACAAAACTTAATTGG - Intronic
945564337 2:211378051-211378073 AGAAAGGAACAGGACAGCATCGG + Exonic
945645669 2:212489138-212489160 AGTATAAAATAAGACAGAATTGG + Intronic
945761218 2:213917758-213917780 AGGAAAGAAAAAGAAAGAAAAGG - Intronic
945801261 2:214434229-214434251 AGTAAAGACCAATAAAGCATTGG - Intronic
945897929 2:215505481-215505503 AATACAGAACAGGAAAGAATGGG + Intergenic
946657535 2:221964421-221964443 ATTAAAAAAAAAAACAGAATGGG - Intergenic
947275916 2:228391589-228391611 AGAAAACAACAAGACAGTCTAGG - Intergenic
947912217 2:233808879-233808901 AGTAATGAGCAAGACAGACTAGG - Intronic
948537197 2:238655019-238655041 AGCAAAGACCAAGACAAAAGAGG + Intergenic
948546684 2:238736973-238736995 AGTTAAAAACAGGAAAGAATAGG + Intergenic
1168934533 20:1652172-1652194 AGTAAAGAACAAGGCAGAGAGGG - Intronic
1169039975 20:2485233-2485255 AGTAATGAACAAGAAAGACATGG + Intronic
1169680385 20:8205512-8205534 AGAAAAAAATAAGACAGAAGGGG + Intronic
1169843158 20:9961725-9961747 TTCAAAGAACTAGACAGAATTGG - Intergenic
1170239175 20:14144115-14144137 AGTAAAGAACATGAAAAAACAGG - Intronic
1170253645 20:14315101-14315123 AATAAAGAGCAAGATAGAAAAGG + Intronic
1170446717 20:16436052-16436074 GGTAGAGAACAAGAAAGAAGAGG - Intronic
1170458837 20:16557900-16557922 ATCCAAGAACAAGACAGAAATGG + Intronic
1170947703 20:20906447-20906469 AATAAAGAACAAGAAAGTAATGG - Intergenic
1171261844 20:23740969-23740991 ATTAAGGAAAAAGACACAATGGG + Intergenic
1171326622 20:24300063-24300085 AGACAAGAAAAAGACAGAAAAGG - Intergenic
1171956572 20:31468395-31468417 AGTGAATAACAAAACAGGATTGG + Intronic
1173009600 20:39169957-39169979 AGTACAGGACCTGACAGAATTGG + Intergenic
1173472268 20:43333074-43333096 AGTAATGAACAAGGCAGACCAGG + Intergenic
1173472680 20:43335939-43335961 AGTAAACAACAATACAGAAGGGG + Intergenic
1174101905 20:48133633-48133655 AGTCAAGAAAAAGACATAAAAGG - Intergenic
1175816934 20:61888036-61888058 TGTAAAGAACAAGAGAAACTTGG + Intronic
1177512574 21:22109005-22109027 ACCAAAGAACAAGACAGATTGGG + Intergenic
1178191541 21:30287633-30287655 AGGAAAGAACATGCCAGAATAGG + Intergenic
1178738196 21:35171717-35171739 AGTACAGATCCACACAGAATGGG + Intronic
1181798875 22:25331024-25331046 AGAAGAGAACAAGACACACTCGG - Intergenic
1182885385 22:33769427-33769449 AGTAATGAACAAGGCAGCAGTGG - Intronic
1182892717 22:33832348-33832370 TCTAAAGAACAAGACAGATCAGG + Intronic
1183026028 22:35066537-35066559 AGTAAAGCCCAGGACTGAATTGG + Exonic
1183233702 22:36599854-36599876 TGAAAAGAACAAGACATATTTGG - Intronic
1183827217 22:40397958-40397980 AAAAAAAAAAAAGACAGAATTGG - Intronic
1184233344 22:43170101-43170123 AGAAAAGAACAAGCCAGGAAAGG + Intronic
1184601718 22:45547761-45547783 ATTAAAGAACAAGTCAGGAGTGG - Intronic
949207372 3:1456077-1456099 AATAAAGAATGACACAGAATTGG - Intergenic
949274741 3:2266047-2266069 AGGAAAGAAAAAGAAAGAAAAGG - Intronic
949863694 3:8529702-8529724 AGTAGAGAATAAGAAAGTATAGG + Intronic
950394334 3:12722247-12722269 AGAAAAGAAAAAGAAAGAAAGGG + Intergenic
950803553 3:15576509-15576531 AGTAAAGAAAAAGAAAGCAAGGG - Intronic
951929630 3:27950959-27950981 AATAAAGCAGAAGAAAGAATTGG - Intergenic
952143586 3:30506286-30506308 AGGAAAGAAGCAGACAGAAAAGG - Intergenic
952803692 3:37323713-37323735 TGAAAAACACAAGACAGAATTGG + Exonic
953335702 3:42092096-42092118 AGTAAAGGACAAAAAAGAAAGGG - Intronic
953621034 3:44532990-44533012 AGTCAAGAACAGGATAGAACAGG - Intergenic
953938742 3:47071315-47071337 AATAAAGAATAAGACAGTATGGG - Intronic
954442293 3:50528351-50528373 AGTAAAGCACAAGGCAAAGTGGG - Intergenic
955483611 3:59414096-59414118 AGAAAAGAACAAGAGAGGAAGGG + Intergenic
955509900 3:59669177-59669199 AGTGAAGAACAAGACAGACCAGG - Intergenic
955653565 3:61220639-61220661 AATATAGAACAAGACAGATGTGG - Intronic
955811695 3:62797633-62797655 AGAGAAGAACAACACACAATGGG + Intronic
955935022 3:64094654-64094676 AGTAAAGATCAAGAAAAAATTGG - Exonic
956332858 3:68130625-68130647 GGAAAAGAACCAGACAGAAAGGG - Intronic
956645631 3:71453006-71453028 AGTAAAGAACTAGGCAGCACAGG - Intronic
956809172 3:72847876-72847898 AGAACAGAACAAGTCAGAACGGG + Intronic
956828902 3:73026345-73026367 AGTCAAGAGCAACACAGAAGAGG - Intronic
956929150 3:74022950-74022972 AGAAAAGAAAGAGTCAGAATAGG - Intergenic
957412968 3:79863813-79863835 CATAAAGAACAAGGAAGAATTGG - Intergenic
957554782 3:81752481-81752503 AGAAAAGAAAAAGACAGAAAAGG + Intronic
957568666 3:81917857-81917879 AAAAAAGAACAGGAGAGAATTGG - Intergenic
958609957 3:96412099-96412121 AGTAAAGAAGAAAAGAGAAGGGG - Intergenic
959297736 3:104558353-104558375 AGAAAGGAACAACACATAATGGG - Intergenic
959809567 3:110599931-110599953 AGAAAAGAAAGAGAGAGAATGGG - Intergenic
959890341 3:111547842-111547864 AGAAAAGAGCAAAACAGAAGGGG + Intronic
959896324 3:111610973-111610995 AGTGATGAACAAGACAGACAGGG + Intronic
960271571 3:115680066-115680088 AGAAAAGAAGGAGACAGAATGGG - Intronic
960824594 3:121769183-121769205 AGTAGAGCACAAGAGAGAAGTGG - Intergenic
960869195 3:122232251-122232273 AGCAATGAACAAGACAGACCAGG + Intronic
960892113 3:122459993-122460015 AGTAAAGAACAGCACACAAGGGG + Intronic
961990808 3:131188751-131188773 AGTAGTGAGCAAGACAGACTTGG + Intronic
962096137 3:132295181-132295203 AGAACAGAACAAAACAGGATAGG - Intergenic
962452536 3:135532438-135532460 AGGAAAGAATAACAGAGAATGGG + Intergenic
962630595 3:137271762-137271784 AGTGATGAACAAGACAGACATGG - Intergenic
963021607 3:140877294-140877316 ATTAAGGAAAAAGACACAATGGG + Intergenic
963389054 3:144633963-144633985 AGAAAAAAACAAGACAAAAATGG + Intergenic
963540702 3:146583957-146583979 AGTAAAGGACAAGAGAAGATAGG + Intronic
963708546 3:148719291-148719313 AGGAAAAAAAAAGCCAGAATGGG + Intronic
963783965 3:149514266-149514288 ACTAAGGAAGAAGATAGAATGGG + Intergenic
964779259 3:160317107-160317129 AGAAGTGAACAAGACAGATTTGG - Intronic
965044359 3:163556340-163556362 AGTAAAGAAGAAGAGAAAGTTGG + Intergenic
965254292 3:166384509-166384531 ATTAAAGAACAATAGAAAATAGG + Intergenic
965999582 3:174931252-174931274 TGTAAAGTACAATAAAGAATAGG + Intronic
966227034 3:177609000-177609022 AGAAAGGAAATAGACAGAATGGG + Intergenic
966400702 3:179544319-179544341 AGAAAAAAAAAAGACATAATTGG + Intergenic
966843045 3:184105104-184105126 GGTAAGGAACAAGACAGACTTGG - Intronic
967340673 3:188393823-188393845 AGTGAAGAAAAAAACAAAATTGG - Intronic
967369183 3:188724380-188724402 AGTAGAGGAAAAAACAGAATAGG - Intronic
968016609 3:195340556-195340578 AGTGAAGCCCAAGACAGAAATGG + Intronic
968246162 3:197151209-197151231 AGAAAAGGGCAAGAAAGAATAGG + Intronic
970485499 4:16520876-16520898 GGTAAAGAACAGAACAGAAGGGG - Intronic
970779034 4:19713342-19713364 AGAAAAGAACAAACCAGAAAAGG - Intergenic
970784297 4:19777509-19777531 AGGAAATAAAAAGACAGAAAAGG + Intergenic
970960463 4:21865382-21865404 AGGATAGAACAAGACAGGATAGG + Intronic
972191389 4:36595953-36595975 AGTCACAGACAAGACAGAATAGG - Intergenic
972276162 4:37559978-37560000 AGTAGGGAAAAGGACAGAATAGG - Intronic
972398905 4:38681699-38681721 AGAAAAGAGCAAGACAGAGTGGG - Intronic
972410456 4:38788243-38788265 GGCAAAGAACAAGAGAGAAATGG + Intergenic
972826337 4:42764046-42764068 AGTGAAGAACGAGGCAGAAGGGG - Intergenic
972861381 4:43173210-43173232 AGTGGGGAACAAGACACAATGGG + Intergenic
972912903 4:43840757-43840779 AGTAAATAACAATATAAAATGGG - Intergenic
972946518 4:44263593-44263615 AGGAAAGAACAGGAAAGAATAGG + Intronic
973681843 4:53328659-53328681 TGTAAAGAAAATGATAGAATTGG + Intronic
973951722 4:56022291-56022313 AGTAAAGAGCAAGAAAGACATGG - Intronic
974099217 4:57398453-57398475 AGTCTAGATCAAGAGAGAATTGG + Intergenic
974173906 4:58301068-58301090 AGTAAAGCCCAAGACACAAAGGG - Intergenic
974360541 4:60872726-60872748 AGTGAAGGACAAAAGAGAATGGG + Intergenic
974678320 4:65126054-65126076 TGTAAAGATCAAAACAGAAGTGG - Intergenic
974901415 4:68003325-68003347 AGAAAAGAAAGATACAGAATGGG + Intergenic
975205291 4:71638512-71638534 AGAACAGAACAAAACAGAACAGG - Intergenic
975232828 4:71954790-71954812 AGTAAAGAACAGTAAAGAATGGG + Intergenic
975382561 4:73718369-73718391 AGAACTGAACAAGACAGCATAGG - Intergenic
975653692 4:76620096-76620118 AGAAAAGAAAAAGAAACAATAGG + Intronic
975747722 4:77491343-77491365 AGAAAAGAAAATGACAGACTAGG + Intergenic
976409499 4:84696846-84696868 AATAAAAAAAAAGAAAGAATGGG + Intronic
977087058 4:92614455-92614477 AATAAATTACAAGACAAAATTGG - Intronic
977967215 4:103167545-103167567 TGTCAAGAAGATGACAGAATAGG + Intronic
978069266 4:104446528-104446550 AATAAGGAATAAGATAGAATCGG + Intergenic
978103318 4:104870704-104870726 AGTAGAGAACAAGACAGATGTGG + Intergenic
978279396 4:106991929-106991951 AGTGACGCAAAAGACAGAATAGG - Intronic
978430114 4:108624749-108624771 AGTAAAAAACAACACATAAGGGG - Intronic
978656175 4:111068010-111068032 AGTAAAGAACAAGATGTAGTAGG + Intergenic
978829822 4:113070843-113070865 AGAAAAGACCAAGGCAAAATGGG - Intronic
979160700 4:117457138-117457160 AGTAAAGACAAAGACAGAGATGG - Intergenic
979608752 4:122668459-122668481 TGTTAAGAATAAGACAGAGTAGG - Intergenic
979709219 4:123758039-123758061 AATAAAGAAACACACAGAATAGG - Intergenic
980097995 4:128512805-128512827 AATAAAGGACAAGATAGAAAGGG - Intergenic
980491038 4:133529730-133529752 ACCAAAGAACAGGACAGACTTGG - Intergenic
980648200 4:135673744-135673766 ATTTAAAAACAAGACAGAGTAGG + Intergenic
981088110 4:140704451-140704473 AGAAAAGGACAAAAAAGAATCGG + Intronic
981650030 4:147046848-147046870 CTTAAAAAACAAGAAAGAATTGG - Intergenic
981963757 4:150576199-150576221 AGGAAGGAACAAGGAAGAATAGG + Intronic
981969611 4:150651596-150651618 AGTTAGGAACAAGACAAACTTGG - Intronic
982152010 4:152469756-152469778 CATAAAGAACAAGAGAGAAAAGG + Intronic
982627730 4:157788672-157788694 AGTAAAGAAAGAGAGAGAAAGGG + Intergenic
982773489 4:159419626-159419648 AGCAAAGAATAATTCAGAATAGG - Intergenic
982774545 4:159428278-159428300 AGTAAAAAAGAGAACAGAATCGG - Intergenic
982881789 4:160729187-160729209 AGTAAAACAAAAGACAGAAGAGG - Intergenic
983332220 4:166344736-166344758 AGAAAAGATCAAGAAAGAAATGG - Intergenic
983367370 4:166810152-166810174 AATAAAGGACAAGACACATTTGG - Intronic
983379566 4:166974537-166974559 TGTAAAGAAAAAGAGAGAAATGG - Intronic
983484208 4:168314957-168314979 AATAAAGAGAAAGACAGAAAAGG + Intronic
983776891 4:171619110-171619132 AGTAAAGAAAAATAAACAATGGG - Intergenic
984613700 4:181871540-181871562 AGTAAAGAGAAAGACATAAAAGG - Intergenic
984926696 4:184813455-184813477 TGCAAAGAGCAAGACAGAAAAGG + Intronic
985406624 4:189645212-189645234 AGTAGAGGAAGAGACAGAATAGG + Intergenic
986216315 5:5722435-5722457 AGTAAAGAACACAATAGCATGGG + Intergenic
986470499 5:8068923-8068945 AGTAAAGAGCAACAAAGAACAGG + Intergenic
987086835 5:14478283-14478305 AGTAAAAAACAAAACAAAACTGG - Intronic
987537549 5:19208019-19208041 GATTAAGAACAAGAAAGAATTGG + Intergenic
987755085 5:22090037-22090059 AGTAAAGATAAAGACTGAAGTGG + Intronic
989071551 5:37517020-37517042 AGTAAAGAACAAGAATATATAGG - Intronic
989271748 5:39541397-39541419 AGTGGAGAACAAGATAGACTTGG + Intergenic
990095982 5:52113748-52113770 AGTAAAGAAAAAAAAAGTATAGG - Intergenic
991119715 5:62997675-62997697 AGTAAAGAAAAAAAAGGAATGGG - Intergenic
991561635 5:67959625-67959647 AGCAAAGAACAAGGCTGACTGGG + Intergenic
991665500 5:68995625-68995647 AGTAGAGATAAAGACAGAAAAGG - Intergenic
992059425 5:73027353-73027375 AAAAAAGAACAAGCCAGACTGGG - Intronic
992106844 5:73456049-73456071 AGAATAGAACAGAACAGAATGGG + Intergenic
992991567 5:82289095-82289117 AAAAAAGAACAAGAGAGAAAAGG + Intronic
993104952 5:83589965-83589987 GGTGATGAACAAGACAGAACAGG - Intergenic
993286943 5:86011642-86011664 AATAAAGACCCAGACAGAATGGG + Intergenic
993423347 5:87730224-87730246 AGAAAAGAACAGAATAGAATAGG - Intergenic
993451364 5:88074922-88074944 AGTAAAAAAAAAGATAAAATGGG - Intergenic
993451551 5:88077025-88077047 AGCCAAGAAAAAGAAAGAATGGG + Intergenic
995278001 5:110299659-110299681 AGTGATAAACAAGACAGAAATGG + Intronic
995545951 5:113231158-113231180 AGTAAAAAACAAAACAAAAAAGG - Intronic
995677462 5:114678722-114678744 AGAAAGTAAAAAGACAGAATAGG + Intergenic
995773358 5:115697541-115697563 AGTAATGAACAAAACAGATGAGG - Intergenic
996329932 5:122317348-122317370 AGAAAAGAAGAAATCAGAATTGG - Intronic
996338129 5:122407064-122407086 GGTAAAGAACAAGACAGACAAGG + Intronic
996594759 5:125187584-125187606 AGAAAATATCAGGACAGAATGGG + Intergenic
996810948 5:127515992-127516014 AGTAACGAACAAGACAGACAAGG - Intergenic
996994850 5:129683309-129683331 AGTAGAGAACAAAACAGACATGG + Intronic
997880442 5:137584239-137584261 AGAAAAGTACAAGATAGAATTGG + Intronic
997923106 5:138001687-138001709 AGTTATGAACAAAACAGAACAGG + Intronic
998161598 5:139815664-139815686 ATTAAAGAAAAAGAAAGAAATGG - Intronic
998786575 5:145716204-145716226 AATGACGAACAAGACAGGATAGG - Intronic
999523147 5:152373489-152373511 AGTAAACAAAAAGACAAAAAAGG - Intergenic
999600675 5:153260452-153260474 AGTATACAGTAAGACAGAATAGG + Intergenic
1000769937 5:165340307-165340329 AATAAAGAACAAGATAAAATTGG - Intergenic
1000855340 5:166391068-166391090 AGTTAAAAACAAGACATAATTGG - Intergenic
1000969233 5:167695732-167695754 AAAAAAAAACAAAACAGAATTGG + Intronic
1001273026 5:170329979-170330001 AGAGAAGAACAAGAAAGAAGAGG + Intergenic
1003650329 6:7953510-7953532 AGTAAAGAAGTAGACAAATTGGG + Intronic
1003906884 6:10709240-10709262 AGTAAAGAACAGTCCAAAATTGG + Exonic
1004812712 6:19277164-19277186 ATTAAAGAAAAAGACACAATGGG + Intergenic
1005767478 6:29027289-29027311 AGTCAAGGACAAAAAAGAATTGG + Intergenic
1006486715 6:34348795-34348817 ACAAAAGAACAAGTCAGACTTGG + Intronic
1006528970 6:34633699-34633721 AGTAAAAAACAAGACAGGCATGG + Intronic
1006949756 6:37811816-37811838 AAGCAAGAACAAGAGAGAATTGG - Intergenic
1007594221 6:43041607-43041629 AGTAAAGAAAGAGAAAGAAAGGG + Intronic
1007968478 6:46026475-46026497 AGTAAAGTACATGACAAAAACGG - Intronic
1007976359 6:46105530-46105552 AGTAAAGAGAAAGACAGCATAGG - Intergenic
1007982361 6:46171837-46171859 AGTACGGAAAAAGACAAAATAGG - Intergenic
1009419468 6:63449262-63449284 AGAAAAGAAAAAGACAGGCTGGG + Intergenic
1009445864 6:63741316-63741338 AGTAAAAAAGAAAATAGAATAGG + Intronic
1009667411 6:66702687-66702709 AGTAAAGAACAAGACTGTCGAGG - Intergenic
1010292798 6:74158301-74158323 AGAAAAGAAAAAGACAGAATTGG + Intergenic
1010343272 6:74781854-74781876 AGGAAAGGAGAAGAAAGAATGGG + Intergenic
1010951598 6:82043403-82043425 AGTAAACAACAGGACAGAAGAGG + Intergenic
1011370112 6:86627891-86627913 ATCAAAGAACAAGCCAGATTGGG - Intergenic
1011717557 6:90123208-90123230 AGAAGAGAAGAAGACAGAAGTGG + Intronic
1012172747 6:96039747-96039769 AGTAAAGAAAAAGATAGATAAGG - Intronic
1012367970 6:98465346-98465368 AGTGAAGAGAGAGACAGAATAGG + Intergenic
1012560479 6:100574342-100574364 AGAAAAGTACAAAACAGAAATGG + Intronic
1012639726 6:101594636-101594658 AATGAAGAACAAAACAAAATTGG + Intronic
1012742333 6:103033829-103033851 ACTAAAGAAAAAAACAGAAAAGG - Intergenic
1012859374 6:104541212-104541234 ATTACAGAACAACACAGACTGGG + Intergenic
1014065459 6:117119454-117119476 AGAAAAGAACAAGCAAGTATAGG - Intergenic
1014976049 6:127885562-127885584 AGGAAAGAAGAAGAAAGAAAAGG + Intronic
1016125104 6:140391117-140391139 AGGAAGGAAAAAGACATAATTGG + Intergenic
1016164804 6:140927483-140927505 AATAAAGAACAAGAAAAAAGAGG + Intergenic
1016423224 6:143906953-143906975 AGTGGAGAACAACACACAATGGG - Intronic
1016771481 6:147857109-147857131 TGTAGAGAACAAGACACAGTTGG + Intergenic
1017366706 6:153650714-153650736 ATCAAAGGACAAGAGAGAATTGG - Intergenic
1017534284 6:155329914-155329936 TGTAAAGCACTAAACAGAATAGG - Intergenic
1018127908 6:160699352-160699374 AGTAAAGAATAAAATAGACTAGG - Intergenic
1018386780 6:163311725-163311747 ATAAAAGAACAAAACACAATAGG - Intronic
1019167688 6:170109499-170109521 AGAAAAAAACAAAACAGAAGAGG - Intergenic
1019829676 7:3314978-3315000 AGTAAGGAAAAAGTCAGAGTGGG - Intronic
1020025467 7:4896768-4896790 ACTAAAGAAAAAAACAAAATGGG - Intergenic
1020317154 7:6913873-6913895 AGAAAAGAAAAAAACAGAAAAGG + Intergenic
1020830922 7:13094522-13094544 ATTAAAGAAAATGATAGAATGGG - Intergenic
1021084435 7:16405369-16405391 AGTAAATAAAAAGACAGATTTGG + Intronic
1021857984 7:24876824-24876846 AGTAGTGAACAAGACAGAAAAGG - Intronic
1021868005 7:24978380-24978402 AGTGATGAACAAGACAGACAAGG + Intronic
1022298433 7:29079919-29079941 AGTTGACAACAAGTCAGAATGGG + Intronic
1022436680 7:30393250-30393272 ACAAAAGAACAAGCCAGACTGGG - Intronic
1023047100 7:36219679-36219701 AGGAAAGAAGAAGAAAGAAGTGG + Intronic
1023631426 7:42168272-42168294 AGTAAAGAACAGCACAGACTTGG - Intronic
1023665534 7:42519207-42519229 ACTAAAGAACAAATCAAAATTGG - Intergenic
1024677365 7:51648839-51648861 ACTATGGAATAAGACAGAATGGG - Intergenic
1024849443 7:53693837-53693859 AGTTAAATACAAGACAGAAAAGG + Intergenic
1025321592 7:58100170-58100192 AGTAAAGAGAAAGAAAGAAAAGG + Intergenic
1025934591 7:66025008-66025030 AGTAAGGAACAAAACTTAATGGG - Intergenic
1026132900 7:67635079-67635101 AGAAAAGAAAAAGAGAGAAATGG - Intergenic
1026407948 7:70087667-70087689 ATGAAAGAAAATGACAGAATAGG - Intronic
1026524364 7:71141388-71141410 AGAAAAAAAAAAGACAGACTGGG + Intronic
1026577762 7:71587960-71587982 AGTAAATAACAAGACAGGACAGG - Intronic
1027469860 7:78559932-78559954 AGAAAAGAATAAGAAAAAATAGG + Intronic
1027571057 7:79867621-79867643 AGTAAAGAAAAAGTAAGCATTGG - Intergenic
1027830846 7:83175572-83175594 AGCAATGAAGTAGACAGAATAGG + Intergenic
1028415624 7:90577614-90577636 AATGAAGAACAAGAATGAATGGG + Intronic
1028443771 7:90895300-90895322 AGGAAAGAAGAGGAAAGAATGGG - Intronic
1029229035 7:99051009-99051031 AGTAAAGTAGAAGAGAGAAAGGG + Intronic
1029952588 7:104602865-104602887 GCTAAAGAACAAGAGAGAAAAGG + Intronic
1030042237 7:105462065-105462087 AGAAAAGAAAAAGATAGAAAAGG + Intronic
1030459268 7:109810215-109810237 AGTAAAGACAAAGACAAAATAGG - Intergenic
1030474109 7:110006309-110006331 AGTAAAAAACAAAGCAGATTTGG + Intergenic
1030503757 7:110393197-110393219 AGAAAAGAAAAACACTGAATGGG + Intergenic
1030889337 7:114979930-114979952 AGGAAAGCACAAGATAGAAAAGG + Intronic
1030927782 7:115479146-115479168 AGAAAAGAACAGGACAGGAGAGG - Intergenic
1030982302 7:116200574-116200596 TGTGAAGAACAAGGCAAAATTGG + Intergenic
1032486660 7:132292782-132292804 AGTAAACAAAAAGACTTAATAGG + Intronic
1032915133 7:136481206-136481228 AGGAAAGCAGAAGTCAGAATGGG + Intergenic
1033581806 7:142744788-142744810 AGCAACGAAGAAGACAGAAAAGG - Intergenic
1034186486 7:149181739-149181761 AATACAGAACAAGACATGATGGG + Intronic
1034597466 7:152211746-152211768 AATAAAGAAAAAGACCGTATCGG + Intronic
1034609173 7:152349460-152349482 AGAAAAGAAAAAAACAGAAAAGG + Intronic
1034779297 7:153862682-153862704 AGAAAAGAACAAGCTAGATTTGG + Intergenic
1034827990 7:154284343-154284365 GGTAAAGAACACAAAAGAATTGG + Intronic
1034922484 7:155095356-155095378 AGTAAAGTACAAGACAAAACTGG - Intergenic
1036084126 8:5594687-5594709 AGTAAATAAAAAGCCAGACTTGG - Intergenic
1036384765 8:8269557-8269579 GGTGGAGAACAAAACAGAATTGG + Intergenic
1036714179 8:11105354-11105376 AGGAAAGAAAAGGACAGGATGGG - Intronic
1036780050 8:11640364-11640386 AGGTAACAACTAGACAGAATGGG - Intergenic
1037159314 8:15749020-15749042 AGTAAAGCACACTACAGAAGAGG + Intronic
1037331799 8:17750240-17750262 ACTGGAGAACAATACAGAATTGG + Intronic
1037384070 8:18318674-18318696 TGTAAAGAAGAAGACAGGAGTGG - Intergenic
1037679330 8:21081346-21081368 AATAAAGAACAAGAAAAAATGGG - Intergenic
1037780088 8:21861965-21861987 AGCAAAGAACAAGTCAGACATGG - Intergenic
1039246532 8:35614864-35614886 AGTACAGAACAAGAGGGAAAAGG - Intronic
1039644951 8:39271173-39271195 AGTAAAGAAAAAGAATGTATAGG + Intronic
1039645187 8:39274611-39274633 AGTAAAGAAAAAGAATGTATAGG + Intronic
1040400162 8:47042250-47042272 GCCAAAGAACAAGAGAGAATAGG + Intergenic
1041299510 8:56396232-56396254 TGTGGAGAACAAGAGAGAATTGG + Intergenic
1041321344 8:56617111-56617133 AAGTAAGAATAAGACAGAATGGG - Intergenic
1041901950 8:62992310-62992332 AGTAAAGAATAAAAGAGAAGTGG - Intronic
1041943724 8:63418418-63418440 AGGAAAGAACAACAGAAAATAGG - Intergenic
1042286628 8:67119826-67119848 AGGCAATATCAAGACAGAATGGG - Intronic
1042736398 8:71994263-71994285 ATTAAATGACAAGAGAGAATAGG + Intronic
1042864805 8:73347884-73347906 AGCTAAAAACAAGACAGAAGTGG + Intergenic
1043186257 8:77154383-77154405 AGAAAAGAACAAAATAGCATGGG + Intergenic
1043567062 8:81560203-81560225 AGTAAATAACCAGACATAATTGG + Intergenic
1043572696 8:81623103-81623125 AGTCAAGATCAAGGCAAAATAGG + Intergenic
1043653665 8:82633564-82633586 AGTTAAGAACAATGCAGACTGGG - Intergenic
1044456197 8:92395155-92395177 ATTAAGGAAAAAGACACAATGGG - Intergenic
1044670072 8:94670881-94670903 ATAATAGCACAAGACAGAATGGG - Intronic
1044980740 8:97714248-97714270 AGCAAAGAAAAAGAAAGAAAAGG - Intronic
1044982742 8:97732598-97732620 AGAAAAGAAAAAGAAAAAATGGG + Intergenic
1045334103 8:101182986-101183008 ACAAAAGAACAAAACAAAATGGG + Intronic
1045350841 8:101337862-101337884 AGAAAAGAAAAAGAAAGAAGTGG + Intergenic
1045514924 8:102850833-102850855 AGAGAAGAACAAGAATGAATAGG + Intronic
1045938425 8:107710417-107710439 AGAAAAAAACAAGGCAGATTAGG - Intergenic
1046883193 8:119333111-119333133 GGGAAAGAAAAAGACACAATAGG + Intergenic
1047123808 8:121937209-121937231 AGCATAAAACAAGACAGAATAGG - Intergenic
1047312109 8:123700803-123700825 AGAAAAGAAAAAGAGAGAAAGGG - Intronic
1048494119 8:134921064-134921086 AAAAAAGATCAAGACAGCATTGG + Intergenic
1048738102 8:137524275-137524297 AAGAAAGAATGAGACAGAATTGG + Intergenic
1048808250 8:138260996-138261018 AGTAAAGTAGAAGGCAGATTTGG - Intronic
1048931782 8:139321109-139321131 AGGAAGGAACAAGACAGACATGG + Intergenic
1048935340 8:139350542-139350564 TGTAAAGAAAATGACAGACTTGG + Intergenic
1050416302 9:5420859-5420881 AGTAAAGAAAAAAACAGATGGGG + Intronic
1051133029 9:13883919-13883941 AGTAGAGAAACAGACAGATTGGG - Intergenic
1051713325 9:19955944-19955966 TGTAAAATACAAGAAAGAATAGG + Intergenic
1051754736 9:20386532-20386554 AGTAATGAACATTGCAGAATTGG + Intronic
1051803463 9:20963932-20963954 AGTGTTGAACAAGACAGAATAGG - Intronic
1052602823 9:30659303-30659325 AAGAAAGAACAAACCAGAATTGG - Intergenic
1052658787 9:31401438-31401460 AGGACAGAACAAGAAAGAAGAGG + Intergenic
1053374601 9:37594715-37594737 AATAAAGAAGAAGAAAGAAATGG - Intronic
1053530511 9:38876852-38876874 CTTAAAGAACCAGACAAAATTGG - Intergenic
1055642546 9:78331469-78331491 AGTAAAGAACAAAACAGAGATGG - Intergenic
1055906229 9:81296166-81296188 AGTAAAGAACATGAAAGAACAGG + Intergenic
1056095183 9:83245449-83245471 AGTGAAGAAGTTGACAGAATAGG - Exonic
1056423373 9:86452193-86452215 AAGAAAGAACAAGAGAGAAATGG - Intergenic
1056557200 9:87699454-87699476 AGGAAAGGACAGGACAGGATAGG + Intronic
1056566557 9:87777748-87777770 TGCAAAGAAAAAGAAAGAATTGG + Intergenic
1056724066 9:89096881-89096903 AGAAGAGAGCAAGACAGAATGGG + Intronic
1057095878 9:92308855-92308877 TGTAAAGAAACAGACAAAATTGG + Intronic
1057836990 9:98453332-98453354 AGAAAAGAAAAAGAAAGAAAGGG - Intronic
1059623095 9:116030638-116030660 AGTAAGTAACCAGGCAGAATGGG + Intergenic
1059686748 9:116645142-116645164 ACTAAAGAGCCAGACAGAGTTGG - Intronic
1059801460 9:117753444-117753466 AATAGAGTAAAAGACAGAATGGG - Intergenic
1059905418 9:118979025-118979047 AGAATAGAACAAGGCAGAAAAGG + Intergenic
1060260950 9:122073071-122073093 AATAATGAACAAGACAGATGTGG + Intronic
1060354156 9:122888395-122888417 AGTACAAAACAAGATAGAGTTGG + Intronic
1060363152 9:122980484-122980506 AGTCAAGAAGAAGAGAGAAAGGG + Intronic
1060392444 9:123289386-123289408 AGAAAAGAAGAAAAAAGAATAGG - Intergenic
1185803270 X:3032515-3032537 AGAAAAGAAGAAAACAGAAATGG + Intronic
1186225450 X:7394488-7394510 AGCAAAGTAGAAGTCAGAATTGG + Intergenic
1186649412 X:11542509-11542531 AGAAAATAAAAAGAGAGAATTGG + Intronic
1187604388 X:20868197-20868219 AGGAAAGAACAACACACACTGGG - Intergenic
1187630499 X:21164576-21164598 AGTAAAGAAAAACAATGAATTGG + Intergenic
1188061332 X:25605679-25605701 AGTAAAGAACATGAAAAAAAAGG - Intergenic
1188629105 X:32329103-32329125 AGTGACTAACAAGATAGAATAGG + Intronic
1188939675 X:36221467-36221489 AGAAAAGAACAAAATAAAATGGG + Intergenic
1189100058 X:38179714-38179736 AGCAAAGGAAAATACAGAATTGG - Intronic
1189736610 X:44077081-44077103 AGTAAAGAAAAATACAGGTTTGG + Intergenic
1190092768 X:47454085-47454107 AGAAAAGAAAAAGACTGAACAGG + Intronic
1190788984 X:53682521-53682543 AATAAAGAACAGGGCAGACTGGG + Intronic
1191812041 X:65199618-65199640 AGTGGAGAACAACACAGACTGGG - Intergenic
1193804353 X:85976281-85976303 AATAAAGGAGAAGACAGCATCGG - Intronic
1194640833 X:96401732-96401754 AGAAATGAACAAGACAGACAGGG + Intergenic
1194832373 X:98639696-98639718 AGTCAAGAAAAAGAAAGAAAAGG + Intergenic
1195391597 X:104368042-104368064 AGTAAAGAACAAGGCAGGAAAGG - Intergenic
1195448608 X:104982671-104982693 ACTAAAGAACAAGAGAGTTTAGG - Intronic
1195550011 X:106157787-106157809 AATTAAGTACAAGACAGAAAAGG - Intergenic
1195789911 X:108572714-108572736 TGTAAAGAATAAAACAGGATGGG - Intronic
1196628894 X:117912300-117912322 ACTAAAAAACAACAAAGAATGGG + Intronic
1197636019 X:128915629-128915651 AGAAAAGGAAAAGACAGAAGAGG + Intergenic
1197895962 X:131315697-131315719 AGTAGCAAACAAGACAGAAAAGG + Intronic
1198423159 X:136487993-136488015 AGAACAGAACAGAACAGAATGGG - Exonic
1199455801 X:148027286-148027308 AGTCATGAGCAAGACAGACTTGG + Intergenic
1199697088 X:150350409-150350431 AGTAAAGAAAATGACAGGCTTGG - Intergenic
1199945589 X:152663898-152663920 GGTAAGTATCAAGACAGAATGGG - Intergenic
1201243484 Y:11980600-11980622 AGAAAAGAAGAAGAAAGAAGAGG - Intergenic
1201261810 Y:12165865-12165887 AGTAAAAAACAAAACAAAACAGG - Intergenic
1201648559 Y:16261890-16261912 ATTAAGGAAAAAGACACAATGGG - Intergenic
1201654251 Y:16323411-16323433 ATTAAGGAAAAAGACACAATGGG + Intergenic