ID: 1096157297

View in Genome Browser
Species Human (GRCh38)
Location 12:49347753-49347775
Sequence CGCTGCCGCCGATGGAAGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096157297_1096157306 -1 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157306 12:49347775-49347797 GCCACCTGGCGGCCATGGTGCGG 0: 1
1: 0
2: 0
3: 15
4: 153
1096157297_1096157313 11 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157313 12:49347787-49347809 CCATGGTGCGGTGGTGTGGGAGG 0: 1
1: 0
2: 1
3: 33
4: 310
1096157297_1096157317 24 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157317 12:49347800-49347822 GTGTGGGAGGAGCTGGGCCCGGG 0: 1
1: 2
2: 9
3: 77
4: 731
1096157297_1096157308 2 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157308 12:49347778-49347800 ACCTGGCGGCCATGGTGCGGTGG 0: 1
1: 0
2: 0
3: 4
4: 128
1096157297_1096157311 8 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157311 12:49347784-49347806 CGGCCATGGTGCGGTGGTGTGGG 0: 1
1: 0
2: 0
3: 3
4: 102
1096157297_1096157318 28 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157318 12:49347804-49347826 GGGAGGAGCTGGGCCCGGGCTGG 0: 1
1: 0
2: 12
3: 175
4: 1382
1096157297_1096157315 18 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157315 12:49347794-49347816 GCGGTGGTGTGGGAGGAGCTGGG 0: 1
1: 0
2: 1
3: 60
4: 692
1096157297_1096157305 -6 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157305 12:49347770-49347792 GCAGCGCCACCTGGCGGCCATGG 0: 1
1: 0
2: 10
3: 18
4: 221
1096157297_1096157314 17 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157314 12:49347793-49347815 TGCGGTGGTGTGGGAGGAGCTGG 0: 1
1: 0
2: 6
3: 187
4: 2684
1096157297_1096157310 7 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157310 12:49347783-49347805 GCGGCCATGGTGCGGTGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 148
1096157297_1096157319 29 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157319 12:49347805-49347827 GGAGGAGCTGGGCCCGGGCTGGG 0: 1
1: 2
2: 6
3: 115
4: 871
1096157297_1096157316 23 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157316 12:49347799-49347821 GGTGTGGGAGGAGCTGGGCCCGG 0: 1
1: 0
2: 9
3: 106
4: 1287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096157297 Original CRISPR CGCTGCCGCCGATGGAAGGG GGG (reversed) Exonic