ID: 1096157297

View in Genome Browser
Species Human (GRCh38)
Location 12:49347753-49347775
Sequence CGCTGCCGCCGATGGAAGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096157297_1096157313 11 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157313 12:49347787-49347809 CCATGGTGCGGTGGTGTGGGAGG 0: 1
1: 0
2: 1
3: 33
4: 310
1096157297_1096157308 2 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157308 12:49347778-49347800 ACCTGGCGGCCATGGTGCGGTGG 0: 1
1: 0
2: 0
3: 4
4: 128
1096157297_1096157318 28 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157318 12:49347804-49347826 GGGAGGAGCTGGGCCCGGGCTGG 0: 1
1: 0
2: 12
3: 175
4: 1382
1096157297_1096157310 7 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157310 12:49347783-49347805 GCGGCCATGGTGCGGTGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 148
1096157297_1096157306 -1 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157306 12:49347775-49347797 GCCACCTGGCGGCCATGGTGCGG 0: 1
1: 0
2: 0
3: 15
4: 153
1096157297_1096157319 29 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157319 12:49347805-49347827 GGAGGAGCTGGGCCCGGGCTGGG 0: 1
1: 2
2: 6
3: 115
4: 871
1096157297_1096157314 17 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157314 12:49347793-49347815 TGCGGTGGTGTGGGAGGAGCTGG 0: 1
1: 0
2: 6
3: 187
4: 2684
1096157297_1096157315 18 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157315 12:49347794-49347816 GCGGTGGTGTGGGAGGAGCTGGG 0: 1
1: 0
2: 1
3: 60
4: 692
1096157297_1096157305 -6 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157305 12:49347770-49347792 GCAGCGCCACCTGGCGGCCATGG 0: 1
1: 0
2: 10
3: 18
4: 221
1096157297_1096157311 8 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157311 12:49347784-49347806 CGGCCATGGTGCGGTGGTGTGGG 0: 1
1: 0
2: 0
3: 3
4: 102
1096157297_1096157316 23 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157316 12:49347799-49347821 GGTGTGGGAGGAGCTGGGCCCGG 0: 1
1: 0
2: 9
3: 106
4: 1287
1096157297_1096157317 24 Left 1096157297 12:49347753-49347775 CCCCCCTTCCATCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1096157317 12:49347800-49347822 GTGTGGGAGGAGCTGGGCCCGGG 0: 1
1: 2
2: 9
3: 77
4: 731

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096157297 Original CRISPR CGCTGCCGCCGATGGAAGGG GGG (reversed) Exonic
900313850 1:2047646-2047668 TGATGCCGCCGGTGGAGGGGGGG - Intergenic
900680930 1:3915777-3915799 CTCTGCCACCGAGGGGAGGGAGG - Intergenic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
904141262 1:28355335-28355357 CCCTGCCGCCCATGGTAGGTTGG + Intergenic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
910251128 1:85200686-85200708 CTCGGCCACCGCTGGAAGGGAGG + Exonic
910360539 1:86410708-86410730 CGCAGCTGCTGCTGGAAGGGTGG + Intergenic
913072999 1:115318093-115318115 CCCTGCAGGCCATGGAAGGGAGG - Intronic
923140890 1:231161279-231161301 CGCTGCTGCCGAGGGAAGGCTGG - Intergenic
923163410 1:231337382-231337404 CGCCGCCGCCTCTGGAGGGGAGG - Exonic
1067479308 10:46584932-46584954 CCATGCCGCTGATGGAAAGGTGG - Intronic
1067615431 10:47756869-47756891 CCATGCCGCTGATGGAAAGGTGG + Intergenic
1077048418 11:556025-556047 CGCAGCCGCGGATGGAGAGGAGG + Exonic
1077136229 11:1000497-1000519 CGCTGCCGCCGGAGGAGGGTGGG - Exonic
1078845320 11:15114679-15114701 CGCTCCTGCAGATGGGAGGGAGG + Intronic
1080592468 11:33736091-33736113 GGCTGCCCCCGAGGGAATGGGGG + Intronic
1087539653 11:99499448-99499470 GGCTGCATCCTATGGAAGGGAGG - Intronic
1091275387 11:134346170-134346192 CTATGCCCCCGAGGGAAGGGCGG - Intronic
1096157297 12:49347753-49347775 CGCTGCCGCCGATGGAAGGGGGG - Exonic
1098375696 12:69811217-69811239 CACTGCCGCTTGTGGAAGGGTGG + Intronic
1102300347 12:111766877-111766899 CGCGGCAGCCAATGGAAAGGCGG - Intronic
1104517940 12:129445293-129445315 CGCTGGGGCCTATGGGAGGGTGG + Intronic
1104637596 12:130447790-130447812 GGCTGCACCAGATGGAAGGGAGG + Intronic
1122858048 14:104569310-104569332 CGCTGCTGTGGATGGGAGGGTGG - Intronic
1132464820 16:72559-72581 GGCTGCCGCCGCTGGCCGGGAGG + Exonic
1135064092 16:19294900-19294922 CCCTGCCCCAGATGGAAGGCAGG - Intronic
1135821728 16:25691913-25691935 CGGCGCCGCCGAGGGAAGGGGGG - Intergenic
1142764167 17:2056443-2056465 AGCGGCCGCCGGTGGAGGGGAGG - Intronic
1143032887 17:3977472-3977494 TGCTGGGGCCGATGGAAGGATGG + Intergenic
1145765579 17:27456467-27456489 TGCTGCCGCGGCTGGGAGGGTGG + Intergenic
1147986224 17:44309016-44309038 CGCTGCCGCGGAGAAAAGGGAGG + Intronic
1148051058 17:44770070-44770092 CGGGGCCGGGGATGGAAGGGAGG + Intronic
1152563984 17:81092006-81092028 AGCTGCCGCTGATGAAGGGGAGG + Intronic
1152644561 17:81462853-81462875 CGATGCGGCCGATGTAGGGGAGG - Exonic
1163121933 19:15223529-15223551 CGCGGCCGCCGGCGGGAGGGAGG - Intergenic
1163513084 19:17747723-17747745 CGCAGCCGCGGAGGGAGGGGCGG + Exonic
1165697622 19:37912889-37912911 AGCTGCCGCTGAAAGAAGGGAGG + Intronic
1165899706 19:39163354-39163376 AGCTGCTGCCCCTGGAAGGGAGG - Intronic
1167019018 19:46860895-46860917 CGCTGCCGCCATTGCGAGGGAGG + Intergenic
930033899 2:47073927-47073949 CGCTGCAGCCGCAGGGAGGGAGG + Exonic
1173330896 20:42075521-42075543 AGCTGCAGCCTAAGGAAGGGTGG + Exonic
954414233 3:50385138-50385160 TGCTGCAGCCGATGGGAGGGGGG + Intronic
956764604 3:72473836-72473858 CGCTGTCTCCTCTGGAAGGGAGG - Intergenic
961524165 3:127486035-127486057 GACTGCAGCCGATGGAGGGGTGG + Intergenic
964433044 3:156625144-156625166 CGCAGCTGCTGCTGGAAGGGTGG - Intergenic
965980639 3:174685827-174685849 CACTGCGGCCTATGGAAGGGTGG - Intronic
967904140 3:194486919-194486941 CGCCGCCGCGGAGGGGAGGGGGG - Intronic
972754301 4:42029169-42029191 AGCTGCCGCAGTCGGAAGGGTGG - Intronic
974892304 4:67896815-67896837 CCCTGCCGCCGCTGGCAGTGAGG - Intergenic
978361127 4:107931875-107931897 CTCCGCCGCCGGAGGAAGGGAGG - Exonic
985824063 5:2180021-2180043 CGCAGCCGCTCCTGGAAGGGGGG - Intergenic
987113994 5:14712523-14712545 CGATGCTGCCGATGGGAGAGGGG - Intronic
987316680 5:16730844-16730866 CGCTGCGGAGGATGGAAGGTGGG + Intronic
991334810 5:65535223-65535245 CCCTGTCGAGGATGGAAGGGAGG + Intronic
999570174 5:152911006-152911028 CGCTGGCGTCGATCAAAGGGTGG - Intergenic
999729748 5:154467869-154467891 GGCTGCCACCGATTGAGGGGAGG - Intergenic
999770472 5:154771666-154771688 CTCTGCCTCCGCTGGCAGGGTGG + Intronic
1001483515 5:172104251-172104273 CACTGCCACTGATGGAAGAGGGG - Intronic
1001825979 5:174745377-174745399 CGCTGCAGCCTCTGGAGGGGAGG + Intergenic
1002926818 6:1609832-1609854 GGCTGCCGCCGCTGGCGGGGCGG + Intergenic
1005549230 6:26897560-26897582 CTCTGCAGCAGATGCAAGGGGGG - Intergenic
1005549408 6:26898377-26898399 CTCTGCAGCAGATGCAAGGGGGG - Intergenic
1009019973 6:57938670-57938692 CTCTGCAGCAGATGCAAGGGGGG - Intergenic
1012416776 6:99021151-99021173 CGCTGCTGCTGCTGGAAGGGCGG + Intergenic
1019270436 7:144090-144112 CGCTGCAGCCCCTGGAGGGGAGG + Intergenic
1019614272 7:1951989-1952011 TGCTGCCACTGATGGAAGAGTGG - Intronic
1021886667 7:25146277-25146299 CGCTGCCTGAGATGGAATGGTGG + Intronic
1021969383 7:25951427-25951449 CGCGGCCGGCGCTGGGAGGGCGG + Intergenic
1032039446 7:128546857-128546879 CGCTTCAGCCCATGGAACGGAGG + Intergenic
1038761086 8:30384666-30384688 GGCTGCAGCCGCTGGAAGGAGGG - Exonic
1044973776 8:97644338-97644360 CGCTGCCACCGCGGGGAGGGCGG - Exonic
1047765964 8:127990199-127990221 CGCTGCCGTCCAGGGGAGGGGGG - Intergenic
1052970897 9:34376706-34376728 CGCTCCCACCGATGAATGGGTGG - Intronic
1057239067 9:93392484-93392506 CGCAGCTGCTGCTGGAAGGGTGG + Intergenic
1059176799 9:112175340-112175362 CGGCGCCGCCGAGGGAAGCGGGG + Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062633310 9:137477116-137477138 CGCTGCCCCCAAAGGAAGGGAGG - Intronic